\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114401329:

Variant ID: vg1114401329 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14401329
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATCTTGTCCTTCCGACGAGAATCACGAGCCGACAAGGACAATTTCTGAGGCAACAAGGTCCTGGTGTTTTATCCACAAAACCAGGAAACACACCTTG[T/C]
AGGCTTGCTGGGTTTTTCTCGACGTACAAGCTGAGATCTGTGCCTGCAAAGAGCGTGGAATTCAATGTACTTCTCTAACCCGTGATGTCTATTGTCATAT

Reverse complement sequence

ATATGACAATAGACATCACGGGTTAGAGAAGTACATTGAATTCCACGCTCTTTGCAGGCACAGATCTCAGCTTGTACGTCGAGAAAAACCCAGCAAGCCT[A/G]
CAAGGTGTGTTTCCTGGTTTTGTGGATAAAACACCAGGACCTTGTTGCCTCAGAAATTGTCCTTGTCGGCTCGTGATTCTCGTCGGAAGGACAAGATTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 29.00% 0.51% 4.49% NA
All Indica  2759 98.50% 1.20% 0.25% 0.04% NA
All Japonica  1512 4.00% 82.40% 0.86% 12.76% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 2.30% 0.89% 0.13% NA
Temperate Japonica  767 4.20% 80.20% 0.91% 14.73% NA
Tropical Japonica  504 4.00% 89.70% 0.40% 5.95% NA
Japonica Intermediate  241 3.30% 74.30% 1.66% 20.75% NA
VI/Aromatic  96 16.70% 64.60% 2.08% 16.67% NA
Intermediate  90 63.30% 32.20% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114401329 T -> DEL N N silent_mutation Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1114401329 T -> C LOC_Os11g25260.1 upstream_gene_variant ; 3206.0bp to feature; MODIFIER silent_mutation Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1114401329 T -> C LOC_Os11g25270.1 upstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1114401329 T -> C LOC_Os11g25280.1 upstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1114401329 T -> C LOC_Os11g25260-LOC_Os11g25270 intergenic_region ; MODIFIER silent_mutation Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114401329 NA 2.33E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 2.45E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 5.98E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 4.65E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 7.56E-07 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 3.14E-23 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 2.60E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 6.67E-06 8.66E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 2.30E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 8.58E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 1.46E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 4.24E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114401329 NA 4.78E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251