Variant ID: vg1114401329 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 14401329 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 291. )
CAAATCTTGTCCTTCCGACGAGAATCACGAGCCGACAAGGACAATTTCTGAGGCAACAAGGTCCTGGTGTTTTATCCACAAAACCAGGAAACACACCTTG[T/C]
AGGCTTGCTGGGTTTTTCTCGACGTACAAGCTGAGATCTGTGCCTGCAAAGAGCGTGGAATTCAATGTACTTCTCTAACCCGTGATGTCTATTGTCATAT
ATATGACAATAGACATCACGGGTTAGAGAAGTACATTGAATTCCACGCTCTTTGCAGGCACAGATCTCAGCTTGTACGTCGAGAAAAACCCAGCAAGCCT[A/G]
CAAGGTGTGTTTCCTGGTTTTGTGGATAAAACACCAGGACCTTGTTGCCTCAGAAATTGTCCTTGTCGGCTCGTGATTCTCGTCGGAAGGACAAGATTTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.00% | 29.00% | 0.51% | 4.49% | NA |
All Indica | 2759 | 98.50% | 1.20% | 0.25% | 0.04% | NA |
All Japonica | 1512 | 4.00% | 82.40% | 0.86% | 12.76% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.70% | 2.30% | 0.89% | 0.13% | NA |
Temperate Japonica | 767 | 4.20% | 80.20% | 0.91% | 14.73% | NA |
Tropical Japonica | 504 | 4.00% | 89.70% | 0.40% | 5.95% | NA |
Japonica Intermediate | 241 | 3.30% | 74.30% | 1.66% | 20.75% | NA |
VI/Aromatic | 96 | 16.70% | 64.60% | 2.08% | 16.67% | NA |
Intermediate | 90 | 63.30% | 32.20% | 2.22% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1114401329 | T -> DEL | N | N | silent_mutation | Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
vg1114401329 | T -> C | LOC_Os11g25260.1 | upstream_gene_variant ; 3206.0bp to feature; MODIFIER | silent_mutation | Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
vg1114401329 | T -> C | LOC_Os11g25270.1 | upstream_gene_variant ; 806.0bp to feature; MODIFIER | silent_mutation | Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
vg1114401329 | T -> C | LOC_Os11g25280.1 | upstream_gene_variant ; 2921.0bp to feature; MODIFIER | silent_mutation | Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
vg1114401329 | T -> C | LOC_Os11g25260-LOC_Os11g25270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.648; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1114401329 | NA | 2.33E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 2.45E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 5.98E-21 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 4.65E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | 7.56E-07 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 3.14E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 2.60E-87 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | 6.67E-06 | 8.66E-07 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 2.30E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 8.58E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 1.46E-23 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 4.24E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1114401329 | NA | 4.78E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |