\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113882833:

Variant ID: vg1113882833 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13882833
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTGTCGATTTGTGCCGTAAATTGTCCGCCGCCGCTGCGAGAGTGTGACACATCTTTGTAGGTTTGTCCTGAAAACCTTTCGTTTTGCCCACGAAAC[A/G]
TGTAATTATCCTCATATCGATCTAAACCGGCTTAGAGGCTGATTTTGATCTCTAAATCGGCTCCGTTAGCCGGTTTAGTTGTTTTTCTACATAACCCATC

Reverse complement sequence

GATGGGTTATGTAGAAAAACAACTAAACCGGCTAACGGAGCCGATTTAGAGATCAAAATCAGCCTCTAAGCCGGTTTAGATCGATATGAGGATAATTACA[T/C]
GTTTCGTGGGCAAAACGAAAGGTTTTCAGGACAAACCTACAAAGATGTGTCACACTCTCGCAGCGGCGGCGGACAATTTACGGCACAAATCGACAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 46.20% 0.36% 1.99% NA
All Indica  2759 32.00% 67.60% 0.36% 0.04% NA
All Japonica  1512 90.10% 3.40% 0.46% 6.02% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 10.80% 88.90% 0.34% 0.00% NA
Indica II  465 57.60% 42.20% 0.22% 0.00% NA
Indica III  913 28.60% 71.00% 0.44% 0.00% NA
Indica Intermediate  786 37.00% 62.50% 0.38% 0.13% NA
Temperate Japonica  767 83.20% 4.30% 0.91% 11.60% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113882833 A -> DEL N N silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1113882833 A -> G LOC_Os11g24340-LOC_Os11g24360 intergenic_region ; MODIFIER silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113882833 NA 1.72E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 5.44E-15 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.13E-08 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 5.13E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 8.28E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.87E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 6.90E-06 NA mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 2.00E-06 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 8.52E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 3.20E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.26E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 4.83E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.94E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 5.70E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 6.10E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.61E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113882833 NA 1.27E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251