Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1113507889:

Variant ID: vg1113507889 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13507889
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

ATCAAGTCGCACGTAAAACAATATAAACGATGATTATTTTTCATGAAATCAGATGTTTTCTTTACTTGAAACACACAGTTCTTTTCGCATTGCACAATGC[C/T]
GAACCGGATTTTTTTATAAGCGCATGCTTTTTTCGCGTTTGGTCAGACAGGTTTTTTAGAGCGGTTTTTTATAAATGCCTTTTTTTTCTTGCGTGGAGTC

Reverse complement sequence

GACTCCACGCAAGAAAAAAAAGGCATTTATAAAAAACCGCTCTAAAAAACCTGTCTGACCAAACGCGAAAAAAGCATGCGCTTATAAAAAAATCCGGTTC[G/A]
GCATTGTGCAATGCGAAAAGAACTGTGTGTTTCAAGTAAAGAAAACATCTGATTTCATGAAAAATAATCATCGTTTATATTGTTTTACGTGCGACTTGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	1.20%	0.61%	0.00%	NA
All Indica	2759	96.90%	2.10%	1.05%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	90.30%	6.90%	2.80%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	96.30%	2.80%	0.89%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113507889	C -> T	LOC_Os11g23860.1	downstream_gene_variant ; 1970.0bp to feature; MODIFIER	silent_mutation	Average:50.561; most accessible tissue: Zhenshan97 flag leaf, score: 78.0	N	N	N	N
vg1113507889	C -> T	LOC_Os11g23850-LOC_Os11g23860	intergenic_region ; MODIFIER	silent_mutation	Average:50.561; most accessible tissue: Zhenshan97 flag leaf, score: 78.0	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113507889	NA	4.66E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	1.15E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.63E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	3.03E-06	3.03E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	8.40E-07	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	3.88E-06	mr1304	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	3.34E-07	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	1.72E-07	mr1432	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.60E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	5.17E-07	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	7.37E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	2.81E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	8.74E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.74E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	8.82E-09	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	5.36E-11	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.80E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	1.09E-07	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.54E-08	mr1956	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	5.53E-08	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	4.80E-07	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	2.36E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	3.19E-06	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	2.89E-09	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	2.09E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113507889	NA	1.81E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251