\
| Variant ID: vg1113389475 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13389475 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 250. )
TGGAGGGAGGAGACTGATTTTCTTGAGAAGAGGGAGGAAGAACGGTTTCTTGAAGAGGGGAGTACACAGATGCATTTTAAAGTTTAACCCTCCACATGCA[G/A]
TAACACTATAGCATCATGGTGGGAAAGATTTTAAAAAATAATACATATCTTGTGAGATATTGCTTTTCAAAGATTGGCATTTTGAACTTTAACCCTCCAC
GTGGAGGGTTAAAGTTCAAAATGCCAATCTTTGAAAAGCAATATCTCACAAGATATGTATTATTTTTTAAAATCTTTCCCACCATGATGCTATAGTGTTA[C/T]
TGCATGTGGAGGGTTAAACTTTAAAATGCATCTGTGTACTCCCCTCTTCAAGAAACCGTTCTTCCTCCCTCTTCTCAAGAAAATCAGTCTCCTCCCTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 5.20% | 2.18% | 0.00% | NA |
| All Indica | 2759 | 87.80% | 8.70% | 3.55% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.90% | 0.20% | 7.90% | 0.00% | NA |
| Indica II | 465 | 80.20% | 13.50% | 6.24% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 87.00% | 10.40% | 2.54% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113389475 | G -> A | LOC_Os11g23230.1 | upstream_gene_variant ; 2963.0bp to feature; MODIFIER | silent_mutation | Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1113389475 | G -> A | LOC_Os11g23232.1 | downstream_gene_variant ; 1125.0bp to feature; MODIFIER | silent_mutation | Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1113389475 | G -> A | LOC_Os11g23234.1 | downstream_gene_variant ; 2561.0bp to feature; MODIFIER | silent_mutation | Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1113389475 | G -> A | LOC_Os11g23230-LOC_Os11g23232 | intergenic_region ; MODIFIER | silent_mutation | Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113389475 | NA | 7.78E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113389475 | NA | 9.68E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113389475 | 8.16E-06 | 7.01E-06 | mr1117_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113389475 | 4.12E-06 | NA | mr1119_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113389475 | 4.51E-06 | NA | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113389475 | 3.29E-06 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |