\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113389475:

Variant ID: vg1113389475 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13389475
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGGAGGAGACTGATTTTCTTGAGAAGAGGGAGGAAGAACGGTTTCTTGAAGAGGGGAGTACACAGATGCATTTTAAAGTTTAACCCTCCACATGCA[G/A]
TAACACTATAGCATCATGGTGGGAAAGATTTTAAAAAATAATACATATCTTGTGAGATATTGCTTTTCAAAGATTGGCATTTTGAACTTTAACCCTCCAC

Reverse complement sequence

GTGGAGGGTTAAAGTTCAAAATGCCAATCTTTGAAAAGCAATATCTCACAAGATATGTATTATTTTTTAAAATCTTTCCCACCATGATGCTATAGTGTTA[C/T]
TGCATGTGGAGGGTTAAACTTTAAAATGCATCTGTGTACTCCCCTCTTCAAGAAACCGTTCTTCCTCCCTCTTCTCAAGAAAATCAGTCTCCTCCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 5.20% 2.18% 0.00% NA
All Indica  2759 87.80% 8.70% 3.55% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.90% 0.20% 7.90% 0.00% NA
Indica II  465 80.20% 13.50% 6.24% 0.00% NA
Indica III  913 89.60% 10.20% 0.22% 0.00% NA
Indica Intermediate  786 87.00% 10.40% 2.54% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113389475 G -> A LOC_Os11g23230.1 upstream_gene_variant ; 2963.0bp to feature; MODIFIER silent_mutation Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1113389475 G -> A LOC_Os11g23232.1 downstream_gene_variant ; 1125.0bp to feature; MODIFIER silent_mutation Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1113389475 G -> A LOC_Os11g23234.1 downstream_gene_variant ; 2561.0bp to feature; MODIFIER silent_mutation Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1113389475 G -> A LOC_Os11g23230-LOC_Os11g23232 intergenic_region ; MODIFIER silent_mutation Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113389475 NA 7.78E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475 NA 9.68E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475 8.16E-06 7.01E-06 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475 4.12E-06 NA mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475 4.51E-06 NA mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475 3.29E-06 NA mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251