\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113156611:

Variant ID: vg1113156611 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13156611
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTCCAACTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTGTCATATATCTTATATAATCTTTGACAATTTTGTTATTTAACCTTCAATCG[G/A]
CTAACATCTATCATTGGAAGGCAGCCGATTAGGTTAAATACCAACGTTGACCTAGATTATATAAGATATCCACCACCCTATGAAACACTGAACGGCTTGA

Reverse complement sequence

TCAAGCCGTTCAGTGTTTCATAGGGTGGTGGATATCTTATATAATCTAGGTCAACGTTGGTATTTAACCTAATCGGCTGCCTTCCAATGATAGATGTTAG[C/T]
CGATTGAAGGTTAAATAACAAAATTGTCAAAGATTATATAAGATATATGACAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGTTGGAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 0.80% 5.35% 25.69% NA
All Indica  2759 49.00% 1.40% 8.74% 40.88% NA
All Japonica  1512 96.30% 0.00% 0.33% 3.37% NA
Aus  269 92.90% 0.40% 1.49% 5.20% NA
Indica I  595 24.90% 0.80% 9.92% 64.37% NA
Indica II  465 67.30% 0.90% 7.31% 24.52% NA
Indica III  913 51.20% 2.20% 9.75% 36.91% NA
Indica Intermediate  786 53.90% 1.10% 7.51% 37.40% NA
Temperate Japonica  767 97.00% 0.00% 0.00% 3.00% NA
Tropical Japonica  504 94.00% 0.00% 0.99% 4.96% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 74.40% 0.00% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113156611 G -> A LOC_Os11g22870.1 upstream_gene_variant ; 932.0bp to feature; MODIFIER silent_mutation Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1113156611 G -> A LOC_Os11g22880.1 upstream_gene_variant ; 3834.0bp to feature; MODIFIER silent_mutation Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1113156611 G -> A LOC_Os11g22870-LOC_Os11g22880 intergenic_region ; MODIFIER silent_mutation Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1113156611 G -> DEL N N silent_mutation Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113156611 3.72E-07 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156611 5.10E-06 NA mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251