\
| Variant ID: vg1113156611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13156611 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )
GCTTCCAACTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTGTCATATATCTTATATAATCTTTGACAATTTTGTTATTTAACCTTCAATCG[G/A]
CTAACATCTATCATTGGAAGGCAGCCGATTAGGTTAAATACCAACGTTGACCTAGATTATATAAGATATCCACCACCCTATGAAACACTGAACGGCTTGA
TCAAGCCGTTCAGTGTTTCATAGGGTGGTGGATATCTTATATAATCTAGGTCAACGTTGGTATTTAACCTAATCGGCTGCCTTCCAATGATAGATGTTAG[C/T]
CGATTGAAGGTTAAATAACAAAATTGTCAAAGATTATATAAGATATATGACAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGTTGGAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.10% | 0.80% | 5.35% | 25.69% | NA |
| All Indica | 2759 | 49.00% | 1.40% | 8.74% | 40.88% | NA |
| All Japonica | 1512 | 96.30% | 0.00% | 0.33% | 3.37% | NA |
| Aus | 269 | 92.90% | 0.40% | 1.49% | 5.20% | NA |
| Indica I | 595 | 24.90% | 0.80% | 9.92% | 64.37% | NA |
| Indica II | 465 | 67.30% | 0.90% | 7.31% | 24.52% | NA |
| Indica III | 913 | 51.20% | 2.20% | 9.75% | 36.91% | NA |
| Indica Intermediate | 786 | 53.90% | 1.10% | 7.51% | 37.40% | NA |
| Temperate Japonica | 767 | 97.00% | 0.00% | 0.00% | 3.00% | NA |
| Tropical Japonica | 504 | 94.00% | 0.00% | 0.99% | 4.96% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113156611 | G -> A | LOC_Os11g22870.1 | upstream_gene_variant ; 932.0bp to feature; MODIFIER | silent_mutation | Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1113156611 | G -> A | LOC_Os11g22880.1 | upstream_gene_variant ; 3834.0bp to feature; MODIFIER | silent_mutation | Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1113156611 | G -> A | LOC_Os11g22870-LOC_Os11g22880 | intergenic_region ; MODIFIER | silent_mutation | Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1113156611 | G -> DEL | N | N | silent_mutation | Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113156611 | 3.72E-07 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156611 | 5.10E-06 | NA | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |