\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113156043:

Variant ID: vg1113156043 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13156043
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCAAATTTGGTAATTCAAGTATCGGAGATGGAACCGAAGCGGAATCCAAGATGGAGATCGTTCTGGAAACAGAGCAAGAATCAGCTAAAGTCCGAAT[C/A,T]
GGCCACGACCAGAATTGGTAGAGTTCGAGTCGGACAAGGTTAGCCGATTGAGCCGATTTCGACAATGTGACTCGGTACACGTTGTCGGGTTGAGTTAATG

Reverse complement sequence

CATTAACTCAACCCGACAACGTGTACCGAGTCACATTGTCGAAATCGGCTCAATCGGCTAACCTTGTCCGACTCGAACTCTACCAATTCTGGTCGTGGCC[G/T,A]
ATTCGGACTTTAGCTGATTCTTGCTCTGTTTCCAGAACGATCTCCATCTTGGATTCCGCTTCGGTTCCATCTCCGATACTTGAATTACCAAATTTGGTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.60% 14.50% 2.88% 37.81% T: 0.19%
All Indica  2759 12.50% 22.30% 4.68% 60.24% T: 0.29%
All Japonica  1512 95.00% 0.40% 0.33% 4.23% T: 0.07%
Aus  269 71.70% 16.40% 0.00% 11.90% NA
Indica I  595 11.30% 2.40% 6.89% 79.33% T: 0.17%
Indica II  465 3.40% 56.80% 4.09% 35.70% NA
Indica III  913 16.00% 14.10% 2.96% 66.37% T: 0.55%
Indica Intermediate  786 14.80% 26.50% 5.34% 53.18% T: 0.25%
Temperate Japonica  767 96.50% 0.30% 0.13% 3.13% NA
Tropical Japonica  504 91.90% 0.60% 0.20% 7.14% T: 0.20%
Japonica Intermediate  241 96.70% 0.40% 1.24% 1.66% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 45.60% 23.30% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113156043 C -> T LOC_Os11g22870.1 upstream_gene_variant ; 364.0bp to feature; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> T LOC_Os11g22880.1 upstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> T LOC_Os11g22870-LOC_Os11g22880 intergenic_region ; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> A LOC_Os11g22870.1 upstream_gene_variant ; 364.0bp to feature; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> A LOC_Os11g22880.1 upstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> A LOC_Os11g22870-LOC_Os11g22880 intergenic_region ; MODIFIER silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg1113156043 C -> DEL N N silent_mutation Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113156043 NA 2.00E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1113156043 4.08E-06 NA mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 4.55E-06 1.10E-09 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 5.24E-07 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 1.52E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 6.69E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 2.00E-10 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 3.24E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 2.00E-08 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 8.77E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 1.46E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 2.94E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 6.94E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 9.14E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043 NA 1.48E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251