\
| Variant ID: vg1113156043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13156043 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 117. )
CGACCAAATTTGGTAATTCAAGTATCGGAGATGGAACCGAAGCGGAATCCAAGATGGAGATCGTTCTGGAAACAGAGCAAGAATCAGCTAAAGTCCGAAT[C/A,T]
GGCCACGACCAGAATTGGTAGAGTTCGAGTCGGACAAGGTTAGCCGATTGAGCCGATTTCGACAATGTGACTCGGTACACGTTGTCGGGTTGAGTTAATG
CATTAACTCAACCCGACAACGTGTACCGAGTCACATTGTCGAAATCGGCTCAATCGGCTAACCTTGTCCGACTCGAACTCTACCAATTCTGGTCGTGGCC[G/T,A]
ATTCGGACTTTAGCTGATTCTTGCTCTGTTTCCAGAACGATCTCCATCTTGGATTCCGCTTCGGTTCCATCTCCGATACTTGAATTACCAAATTTGGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.60% | 14.50% | 2.88% | 37.81% | T: 0.19% |
| All Indica | 2759 | 12.50% | 22.30% | 4.68% | 60.24% | T: 0.29% |
| All Japonica | 1512 | 95.00% | 0.40% | 0.33% | 4.23% | T: 0.07% |
| Aus | 269 | 71.70% | 16.40% | 0.00% | 11.90% | NA |
| Indica I | 595 | 11.30% | 2.40% | 6.89% | 79.33% | T: 0.17% |
| Indica II | 465 | 3.40% | 56.80% | 4.09% | 35.70% | NA |
| Indica III | 913 | 16.00% | 14.10% | 2.96% | 66.37% | T: 0.55% |
| Indica Intermediate | 786 | 14.80% | 26.50% | 5.34% | 53.18% | T: 0.25% |
| Temperate Japonica | 767 | 96.50% | 0.30% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 91.90% | 0.60% | 0.20% | 7.14% | T: 0.20% |
| Japonica Intermediate | 241 | 96.70% | 0.40% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 45.60% | 23.30% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113156043 | C -> T | LOC_Os11g22870.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> T | LOC_Os11g22880.1 | upstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> T | LOC_Os11g22870-LOC_Os11g22880 | intergenic_region ; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> A | LOC_Os11g22870.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> A | LOC_Os11g22880.1 | upstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> A | LOC_Os11g22870-LOC_Os11g22880 | intergenic_region ; MODIFIER | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1113156043 | C -> DEL | N | N | silent_mutation | Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113156043 | NA | 2.00E-13 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1113156043 | 4.08E-06 | NA | mr1277 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | 4.55E-06 | 1.10E-09 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 5.24E-07 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 1.52E-08 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 6.69E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 2.00E-10 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 3.24E-07 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 2.00E-08 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 8.77E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 1.46E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 2.94E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 6.94E-10 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 9.14E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113156043 | NA | 1.48E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |