Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1113156043:

Variant ID: vg1113156043 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13156043
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CGACCAAATTTGGTAATTCAAGTATCGGAGATGGAACCGAAGCGGAATCCAAGATGGAGATCGTTCTGGAAACAGAGCAAGAATCAGCTAAAGTCCGAAT[C/A,T]
GGCCACGACCAGAATTGGTAGAGTTCGAGTCGGACAAGGTTAGCCGATTGAGCCGATTTCGACAATGTGACTCGGTACACGTTGTCGGGTTGAGTTAATG

Reverse complement sequence

CATTAACTCAACCCGACAACGTGTACCGAGTCACATTGTCGAAATCGGCTCAATCGGCTAACCTTGTCCGACTCGAACTCTACCAATTCTGGTCGTGGCC[G/T,A]
ATTCGGACTTTAGCTGATTCTTGCTCTGTTTCCAGAACGATCTCCATCTTGGATTCCGCTTCGGTTCCATCTCCGATACTTGAATTACCAAATTTGGTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.60%	14.50%	2.88%	37.81%	T: 0.19%
All Indica	2759	12.50%	22.30%	4.68%	60.24%	T: 0.29%
All Japonica	1512	95.00%	0.40%	0.33%	4.23%	T: 0.07%
Aus	269	71.70%	16.40%	0.00%	11.90%	NA
Indica I	595	11.30%	2.40%	6.89%	79.33%	T: 0.17%
Indica II	465	3.40%	56.80%	4.09%	35.70%	NA
Indica III	913	16.00%	14.10%	2.96%	66.37%	T: 0.55%
Indica Intermediate	786	14.80%	26.50%	5.34%	53.18%	T: 0.25%
Temperate Japonica	767	96.50%	0.30%	0.13%	3.13%	NA
Tropical Japonica	504	91.90%	0.60%	0.20%	7.14%	T: 0.20%
Japonica Intermediate	241	96.70%	0.40%	1.24%	1.66%	NA
VI/Aromatic	96	95.80%	1.00%	0.00%	3.12%	NA
Intermediate	90	45.60%	23.30%	2.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113156043	C -> T	LOC_Os11g22870.1	upstream_gene_variant ; 364.0bp to feature; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> T	LOC_Os11g22880.1	upstream_gene_variant ; 4402.0bp to feature; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> T	LOC_Os11g22870-LOC_Os11g22880	intergenic_region ; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> A	LOC_Os11g22870.1	upstream_gene_variant ; 364.0bp to feature; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> A	LOC_Os11g22880.1	upstream_gene_variant ; 4402.0bp to feature; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> A	LOC_Os11g22870-LOC_Os11g22880	intergenic_region ; MODIFIER	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1113156043	C -> DEL	N	N	silent_mutation	Average:24.479; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113156043	NA	2.00E-13	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1113156043	4.08E-06	NA	mr1277	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	4.55E-06	1.10E-09	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	5.24E-07	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	1.52E-08	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	6.69E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	2.00E-10	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	3.24E-07	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	2.00E-08	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	8.77E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	1.46E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	2.94E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	6.94E-10	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	9.14E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156043	NA	1.48E-09	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251