\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112964378:

Variant ID: vg1112964378 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12964378
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCAAACCAATATATAAGGTTCAAGCTAATCAATTTATTACCCATAGGAAAATAAAGTCATCTTCAGCCATTAATTAATTAGGAAAGGCTCACCACCC[A/G]
ATGACATTCAAAATTAATGCATAAGTTGAAATAAAACATTAGCTTTAAAAAGGTTCAACATGCTCAAAAGGTTGTTTGGGATCTATGTGACTTGCCTTGA

Reverse complement sequence

TCAAGGCAAGTCACATAGATCCCAAACAACCTTTTGAGCATGTTGAACCTTTTTAAAGCTAATGTTTTATTTCAACTTATGCATTAATTTTGAATGTCAT[T/C]
GGGTGGTGAGCCTTTCCTAATTAATTAATGGCTGAAGATGACTTTATTTTCCTATGGGTAATAAATTGATTAGCTTGAACCTTATATATTGGTTTGGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 15.10% 0.87% 36.20% NA
All Indica  2759 24.10% 16.10% 1.41% 58.39% NA
All Japonica  1512 95.80% 1.40% 0.00% 2.84% NA
Aus  269 5.20% 83.60% 0.37% 10.78% NA
Indica I  595 48.70% 13.30% 0.50% 37.48% NA
Indica II  465 30.30% 6.50% 0.65% 62.58% NA
Indica III  913 3.30% 22.50% 2.08% 72.18% NA
Indica Intermediate  786 25.80% 16.70% 1.78% 55.73% NA
Temperate Japonica  767 97.40% 2.10% 0.00% 0.52% NA
Tropical Japonica  504 92.30% 1.00% 0.00% 6.75% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 86.50% 10.40% 0.00% 3.12% NA
Intermediate  90 56.70% 14.40% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112964378 A -> DEL N N silent_mutation Average:10.544; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1112964378 A -> G LOC_Os11g22540.1 downstream_gene_variant ; 3856.0bp to feature; MODIFIER silent_mutation Average:10.544; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1112964378 A -> G LOC_Os11g22550.1 downstream_gene_variant ; 45.0bp to feature; MODIFIER silent_mutation Average:10.544; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1112964378 A -> G LOC_Os11g22540-LOC_Os11g22550 intergenic_region ; MODIFIER silent_mutation Average:10.544; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112964378 NA 9.55E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 9.08E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.52E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 2.85E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 2.05E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 8.46E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 3.38E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 2.37E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 3.68E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 8.66E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.51E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 4.57E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 3.81E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.47E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 4.08E-95 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.42E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 2.67E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.87E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.27E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 9.83E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 5.54E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 3.96E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.21E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 1.75E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 9.84E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 6.49E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 1.06E-06 5.08E-138 mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 6.96E-06 NA mr1758_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112964378 NA 4.46E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251