\
| Variant ID: vg1112948764 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12948764 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 50. )
AGAAATAAAAGAATATATTATATATCTACAGAAAATTATCTACAACTTTTGTGTTTTTGAGAACAATTTAATTAGGGACTACTTTTGAATTACCCTTGCA[A/G]
CAAGGAACATCAATTCGAGACGAATTTCCACCTTTTCTTCCCTACTCTTCTTTGGAACCGATAAAAAATGTCCTGACAGTTGTCTTCTATTCTCCTCTTG
CAAGAGGAGAATAGAAGACAACTGTCAGGACATTTTTTATCGGTTCCAAAGAAGAGTAGGGAAGAAAAGGTGGAAATTCGTCTCGAATTGATGTTCCTTG[T/C]
TGCAAGGGTAATTCAAAAGTAGTCCCTAATTAAATTGTTCTCAAAAACACAAAAGTTGTAGATAATTTTCTGTAGATATATAATATATTCTTTTATTTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 15.30% | 0.36% | 36.52% | NA |
| All Indica | 2759 | 23.90% | 16.60% | 0.47% | 59.01% | NA |
| All Japonica | 1512 | 95.80% | 1.30% | 0.13% | 2.84% | NA |
| Aus | 269 | 5.60% | 83.60% | 0.00% | 10.78% | NA |
| Indica I | 595 | 48.40% | 13.40% | 0.50% | 37.65% | NA |
| Indica II | 465 | 30.30% | 6.50% | 0.65% | 62.58% | NA |
| Indica III | 913 | 3.40% | 23.40% | 0.66% | 72.51% | NA |
| Indica Intermediate | 786 | 25.40% | 17.00% | 0.13% | 57.38% | NA |
| Temperate Japonica | 767 | 97.10% | 2.10% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 92.70% | 0.60% | 0.20% | 6.55% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 86.50% | 12.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 12.20% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112948764 | A -> DEL | N | N | silent_mutation | Average:11.21; most accessible tissue: Callus, score: 73.772 | N | N | N | N |
| vg1112948764 | A -> G | LOC_Os11g22540.1 | upstream_gene_variant ; 3015.0bp to feature; MODIFIER | silent_mutation | Average:11.21; most accessible tissue: Callus, score: 73.772 | N | N | N | N |
| vg1112948764 | A -> G | LOC_Os11g22530.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.21; most accessible tissue: Callus, score: 73.772 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112948764 | 9.22E-06 | NA | mr1197 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | 2.95E-06 | 2.95E-06 | mr1197 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 2.15E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 9.82E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 1.91E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 3.65E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 2.41E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 1.72E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 4.60E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112948764 | NA | 4.60E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |