\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112948764:

Variant ID: vg1112948764 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12948764
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAATAAAAGAATATATTATATATCTACAGAAAATTATCTACAACTTTTGTGTTTTTGAGAACAATTTAATTAGGGACTACTTTTGAATTACCCTTGCA[A/G]
CAAGGAACATCAATTCGAGACGAATTTCCACCTTTTCTTCCCTACTCTTCTTTGGAACCGATAAAAAATGTCCTGACAGTTGTCTTCTATTCTCCTCTTG

Reverse complement sequence

CAAGAGGAGAATAGAAGACAACTGTCAGGACATTTTTTATCGGTTCCAAAGAAGAGTAGGGAAGAAAAGGTGGAAATTCGTCTCGAATTGATGTTCCTTG[T/C]
TGCAAGGGTAATTCAAAAGTAGTCCCTAATTAAATTGTTCTCAAAAACACAAAAGTTGTAGATAATTTTCTGTAGATATATAATATATTCTTTTATTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 15.30% 0.36% 36.52% NA
All Indica  2759 23.90% 16.60% 0.47% 59.01% NA
All Japonica  1512 95.80% 1.30% 0.13% 2.84% NA
Aus  269 5.60% 83.60% 0.00% 10.78% NA
Indica I  595 48.40% 13.40% 0.50% 37.65% NA
Indica II  465 30.30% 6.50% 0.65% 62.58% NA
Indica III  913 3.40% 23.40% 0.66% 72.51% NA
Indica Intermediate  786 25.40% 17.00% 0.13% 57.38% NA
Temperate Japonica  767 97.10% 2.10% 0.13% 0.65% NA
Tropical Japonica  504 92.70% 0.60% 0.20% 6.55% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 86.50% 12.50% 0.00% 1.04% NA
Intermediate  90 57.80% 12.20% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112948764 A -> DEL N N silent_mutation Average:11.21; most accessible tissue: Callus, score: 73.772 N N N N
vg1112948764 A -> G LOC_Os11g22540.1 upstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:11.21; most accessible tissue: Callus, score: 73.772 N N N N
vg1112948764 A -> G LOC_Os11g22530.1 intron_variant ; MODIFIER silent_mutation Average:11.21; most accessible tissue: Callus, score: 73.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112948764 9.22E-06 NA mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 2.95E-06 2.95E-06 mr1197 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 2.15E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 9.82E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 1.91E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 3.65E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 2.41E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 1.72E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 4.60E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764 NA 4.60E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251