Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112909075:

Variant ID: vg1112909075 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12909075
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AACCGACGGCTCAGACACGGTTTACGACAGAGACTCGGTACAGCAAGCGATAGGCCGGTAGGGGTTTAGGGATGCACCTATGGCTTTGCGACTCGGCTAC[T/C]
GAGCTACGGGCAGCGGCAAACCACGACAGCTAGGCGGTGACACAAGGCAGCGGTGACACGGCAGCTAGGCGGCGGCGGCACGGCTAGGCTACTAGGGTTT

Reverse complement sequence

AAACCCTAGTAGCCTAGCCGTGCCGCCGCCGCCTAGCTGCCGTGTCACCGCTGCCTTGTGTCACCGCCTAGCTGTCGTGGTTTGCCGCTGCCCGTAGCTC[A/G]
GTAGCCGAGTCGCAAAGCCATAGGTGCATCCCTAAACCCCTACCGGCCTATCGCTTGCTGTACCGAGTCTCTGTCGTAAACCGTGTCTGAGCCGTCGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.20%	25.40%	0.40%	26.03%	NA
All Indica	2759	23.80%	33.10%	0.69%	42.44%	NA
All Japonica	1512	96.30%	0.70%	0.00%	2.98%	NA
Aus	269	12.30%	87.70%	0.00%	0.00%	NA
Indica I	595	45.40%	12.60%	1.18%	40.84%	NA
Indica II	465	15.30%	58.90%	0.43%	25.38%	NA
Indica III	913	14.10%	29.20%	0.33%	56.30%	NA
Indica Intermediate	786	23.70%	37.80%	0.89%	37.66%	NA
Temperate Japonica	767	98.70%	0.30%	0.00%	1.04%	NA
Tropical Japonica	504	92.30%	1.20%	0.00%	6.55%	NA
Japonica Intermediate	241	97.10%	1.20%	0.00%	1.66%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	52.20%	32.20%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112909075	T -> DEL	N	N	silent_mutation	Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1112909075	T -> C	LOC_Os11g22460.1	upstream_gene_variant ; 1599.0bp to feature; MODIFIER	silent_mutation	Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1112909075	T -> C	LOC_Os11g22449.1	downstream_gene_variant ; 3582.0bp to feature; MODIFIER	silent_mutation	Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1112909075	T -> C	LOC_Os11g22460-LOC_Os11g22470	intergenic_region ; MODIFIER	silent_mutation	Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112909075	4.75E-06	5.42E-06	mr1053	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	6.55E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	5.36E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	9.77E-06	2.85E-10	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	3.20E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.54E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.32E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.82E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.12E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.37E-08	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	7.80E-08	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.95E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	4.69E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.59E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.41E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.08E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.19E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.66E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	9.42E-08	NA	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	8.90E-08	3.66E-08	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.27E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	2.81E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	7.42E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.92E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	1.19E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	9.83E-13	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075	NA	3.26E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251