\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112909075:

Variant ID: vg1112909075 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12909075
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AACCGACGGCTCAGACACGGTTTACGACAGAGACTCGGTACAGCAAGCGATAGGCCGGTAGGGGTTTAGGGATGCACCTATGGCTTTGCGACTCGGCTAC[T/C]
GAGCTACGGGCAGCGGCAAACCACGACAGCTAGGCGGTGACACAAGGCAGCGGTGACACGGCAGCTAGGCGGCGGCGGCACGGCTAGGCTACTAGGGTTT

Reverse complement sequence

AAACCCTAGTAGCCTAGCCGTGCCGCCGCCGCCTAGCTGCCGTGTCACCGCTGCCTTGTGTCACCGCCTAGCTGTCGTGGTTTGCCGCTGCCCGTAGCTC[A/G]
GTAGCCGAGTCGCAAAGCCATAGGTGCATCCCTAAACCCCTACCGGCCTATCGCTTGCTGTACCGAGTCTCTGTCGTAAACCGTGTCTGAGCCGTCGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 25.40% 0.40% 26.03% NA
All Indica  2759 23.80% 33.10% 0.69% 42.44% NA
All Japonica  1512 96.30% 0.70% 0.00% 2.98% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 45.40% 12.60% 1.18% 40.84% NA
Indica II  465 15.30% 58.90% 0.43% 25.38% NA
Indica III  913 14.10% 29.20% 0.33% 56.30% NA
Indica Intermediate  786 23.70% 37.80% 0.89% 37.66% NA
Temperate Japonica  767 98.70% 0.30% 0.00% 1.04% NA
Tropical Japonica  504 92.30% 1.20% 0.00% 6.55% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 52.20% 32.20% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112909075 T -> DEL N N silent_mutation Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1112909075 T -> C LOC_Os11g22460.1 upstream_gene_variant ; 1599.0bp to feature; MODIFIER silent_mutation Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1112909075 T -> C LOC_Os11g22449.1 downstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1112909075 T -> C LOC_Os11g22460-LOC_Os11g22470 intergenic_region ; MODIFIER silent_mutation Average:43.937; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112909075 4.75E-06 5.42E-06 mr1053 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 6.55E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 5.36E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 9.77E-06 2.85E-10 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 3.20E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.54E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.32E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.82E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.12E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.37E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 7.80E-08 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.95E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 4.69E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.59E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.41E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.08E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.19E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.66E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 9.42E-08 NA mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 8.90E-08 3.66E-08 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.27E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 2.81E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 7.42E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.92E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 1.19E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 9.83E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909075 NA 3.26E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251