\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110783636:

Variant ID: vg1110783636 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10783636
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTGTAAAATTTTCGGCCATCTCTCATTTAAACAAAGCCCGCTTGACGATTAAATTGTGGTTTTAGTCACTAGCTTTCACTCACTCTTCTTTCTTTCC[T/A]
TTCCTCTCTAAATAAAAAAGATTATTTATGGTTAAATCTAAGAGTAAAAAAATAGTCATGGTTCAATAAAGAGTAAAAAAATTAATCATAGTTAAATCTT

Reverse complement sequence

AAGATTTAACTATGATTAATTTTTTTACTCTTTATTGAACCATGACTATTTTTTTACTCTTAGATTTAACCATAAATAATCTTTTTTATTTAGAGAGGAA[A/T]
GGAAAGAAAGAAGAGTGAGTGAAAGCTAGTGACTAAAACCACAATTTAATCGTCAAGCGGGCTTTGTTTAAATGAGAGATGGCCGAAAATTTTACAATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.20% 0.11% 0.00% NA
All Indica  2759 95.30% 4.60% 0.14% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 40.50% 59.10% 0.37% 0.00% NA
Indica I  595 97.00% 2.50% 0.50% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 90.50% 9.40% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110783636 T -> A LOC_Os11g18947.1 downstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg1110783636 T -> A LOC_Os11g18947.2 downstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg1110783636 T -> A LOC_Os11g18947.3 downstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg1110783636 T -> A LOC_Os11g18940-LOC_Os11g18947 intergenic_region ; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110783636 3.34E-06 3.37E-21 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 2.77E-07 8.58E-26 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 4.99E-08 5.94E-23 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 4.37E-06 1.18E-24 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 2.99E-06 5.44E-24 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 1.12E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 8.92E-24 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 9.18E-06 1.53E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 3.23E-06 9.30E-29 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 2.14E-18 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 9.84E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 8.89E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 1.83E-08 1.20E-25 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 9.90E-09 1.10E-26 mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 1.19E-08 2.07E-28 mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 4.71E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 5.96E-08 4.66E-26 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 1.85E-06 1.15E-28 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 1.78E-26 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 5.11E-22 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 1.26E-07 2.14E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 6.94E-07 1.07E-31 mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 1.88E-07 8.59E-18 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 1.31E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110783636 NA 1.30E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251