\
| Variant ID: vg1110542233 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10542233 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 85. )
GCAACCTTATGAGTGTCGTAGGCTCTCCGGACCTTCCATTATATTTGAGAGATGAAATGAATAATTCAAGTCATCAAACAAGCATAATGAAACATCCAAC[G/A]
CCTCGAGAGAGGAATATTGGAGACATTGCTAGGCCCTTAGCCTGCCAGTCAACTTCAGCCTGAGATGTGCCCGTCAAACCACTCGAAGGCAGCGACCAGA
TCTGGTCGCTGCCTTCGAGTGGTTTGACGGGCACATCTCAGGCTGAAGTTGACTGGCAGGCTAAGGGCCTAGCAATGTCTCCAATATTCCTCTCTCGAGG[C/T]
GTTGGATGTTTCATTATGCTTGTTTGATGACTTGAATTATTCATTTCATCTCTCAAATATAATGGAAGGTCCGGAGAGCCTACGACACTCATAAGGTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 30.10% | 0.40% | 1.31% | NA |
| All Indica | 2759 | 51.00% | 47.90% | 0.58% | 0.58% | NA |
| All Japonica | 1512 | 98.60% | 1.10% | 0.13% | 0.20% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.50% | 24.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 17.40% | 81.70% | 0.65% | 0.22% | NA |
| Indica III | 913 | 51.40% | 47.40% | 0.33% | 0.88% | NA |
| Indica Intermediate | 786 | 51.80% | 46.40% | 1.15% | 0.64% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.80% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 52.10% | 5.20% | 0.00% | 42.71% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110542233 | G -> A | LOC_Os11g18660.1 | upstream_gene_variant ; 2878.0bp to feature; MODIFIER | silent_mutation | Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1110542233 | G -> A | LOC_Os11g18660-LOC_Os11g18670 | intergenic_region ; MODIFIER | silent_mutation | Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1110542233 | G -> DEL | N | N | silent_mutation | Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110542233 | NA | 2.83E-08 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.08E-09 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 3.57E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.72E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.52E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 6.79E-07 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.30E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.38E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 1.80E-09 | mr1608 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 3.77E-09 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 7.42E-08 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 7.89E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 6.33E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110542233 | NA | 8.98E-08 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |