Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1110542233:

Variant ID: vg1110542233 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10542233
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACCTTATGAGTGTCGTAGGCTCTCCGGACCTTCCATTATATTTGAGAGATGAAATGAATAATTCAAGTCATCAAACAAGCATAATGAAACATCCAAC[G/A]
CCTCGAGAGAGGAATATTGGAGACATTGCTAGGCCCTTAGCCTGCCAGTCAACTTCAGCCTGAGATGTGCCCGTCAAACCACTCGAAGGCAGCGACCAGA

Reverse complement sequence

TCTGGTCGCTGCCTTCGAGTGGTTTGACGGGCACATCTCAGGCTGAAGTTGACTGGCAGGCTAAGGGCCTAGCAATGTCTCCAATATTCCTCTCTCGAGG[C/T]
GTTGGATGTTTCATTATGCTTGTTTGATGACTTGAATTATTCATTTCATCTCTCAAATATAATGGAAGGTCCGGAGAGCCTACGACACTCATAAGGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	30.10%	0.40%	1.31%	NA
All Indica	2759	51.00%	47.90%	0.58%	0.58%	NA
All Japonica	1512	98.60%	1.10%	0.13%	0.20%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	75.50%	24.00%	0.17%	0.34%	NA
Indica II	465	17.40%	81.70%	0.65%	0.22%	NA
Indica III	913	51.40%	47.40%	0.33%	0.88%	NA
Indica Intermediate	786	51.80%	46.40%	1.15%	0.64%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	97.50%	0.80%	0.41%	1.24%	NA
VI/Aromatic	96	52.10%	5.20%	0.00%	42.71%	NA
Intermediate	90	55.60%	41.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110542233	G -> A	LOC_Os11g18660.1	upstream_gene_variant ; 2878.0bp to feature; MODIFIER	silent_mutation	Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1110542233	G -> A	LOC_Os11g18660-LOC_Os11g18670	intergenic_region ; MODIFIER	silent_mutation	Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1110542233	G -> DEL	N	N	silent_mutation	Average:38.247; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110542233	NA	2.83E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.08E-09	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	3.57E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.72E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.52E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	6.79E-07	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.30E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.38E-08	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	1.80E-09	mr1608	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	3.77E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	7.42E-08	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	7.89E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	6.33E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110542233	NA	8.98E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251