\
| Variant ID: vg1110030990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10030990 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )
ATCGATCTAAATCGGCCTAGAGGCTGGTTTTGATCTCTAAATCGGCTCTGCTAGCCGGTTTAGCTGTTTTTCTACAAAACCCATCTTGATTTGGCCGTTT[A/G,C]
GCTAGATCGAGGTGGTTGGCGACTCCATTTCACCGCAAGGCATTTAGGTGTTGCGATCGTGCTTATCGACTTGTCAAAAAAGTTGCCAACACGATTTTTG
CAAAAATCGTGTTGGCAACTTTTTTGACAAGTCGATAAGCACGATCGCAACACCTAAATGCCTTGCGGTGAAATGGAGTCGCCAACCACCTCGATCTAGC[T/C,G]
AAACGGCCAAATCAAGATGGGTTTTGTAGAAAAACAGCTAAACCGGCTAGCAGAGCCGATTTAGAGATCAAAACCAGCCTCTAGGCCGATTTAGATCGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 0.10% | 4.49% | 49.32% | C: 0.06% |
| All Indica | 2759 | 24.50% | 0.10% | 5.58% | 69.63% | C: 0.11% |
| All Japonica | 1512 | 86.00% | 0.10% | 2.65% | 11.31% | NA |
| Aus | 269 | 21.20% | 0.00% | 6.32% | 72.49% | NA |
| Indica I | 595 | 46.70% | 0.00% | 2.02% | 51.26% | NA |
| Indica II | 465 | 22.80% | 0.00% | 4.73% | 72.47% | NA |
| Indica III | 913 | 5.30% | 0.30% | 8.65% | 85.43% | C: 0.33% |
| Indica Intermediate | 786 | 31.20% | 0.10% | 5.22% | 63.49% | NA |
| Temperate Japonica | 767 | 78.90% | 0.10% | 4.30% | 16.69% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 85.50% | 0.00% | 2.90% | 11.62% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 0.00% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110030990 | A -> DEL | N | N | silent_mutation | Average:12.497; most accessible tissue: Callus, score: 26.238 | N | N | N | N |
| vg1110030990 | A -> G | LOC_Os11g17890.1 | upstream_gene_variant ; 1096.0bp to feature; MODIFIER | silent_mutation | Average:12.497; most accessible tissue: Callus, score: 26.238 | N | N | N | N |
| vg1110030990 | A -> G | LOC_Os11g17880-LOC_Os11g17890 | intergenic_region ; MODIFIER | silent_mutation | Average:12.497; most accessible tissue: Callus, score: 26.238 | N | N | N | N |
| vg1110030990 | A -> C | LOC_Os11g17890.1 | upstream_gene_variant ; 1096.0bp to feature; MODIFIER | silent_mutation | Average:12.497; most accessible tissue: Callus, score: 26.238 | N | N | N | N |
| vg1110030990 | A -> C | LOC_Os11g17880-LOC_Os11g17890 | intergenic_region ; MODIFIER | silent_mutation | Average:12.497; most accessible tissue: Callus, score: 26.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110030990 | 5.15E-06 | 4.47E-07 | mr1201 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030990 | NA | 1.28E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030990 | NA | 9.00E-08 | mr1382 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030990 | NA | 2.71E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030990 | NA | 2.77E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030990 | NA | 3.56E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |