\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110030990:

Variant ID: vg1110030990 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10030990
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGATCTAAATCGGCCTAGAGGCTGGTTTTGATCTCTAAATCGGCTCTGCTAGCCGGTTTAGCTGTTTTTCTACAAAACCCATCTTGATTTGGCCGTTT[A/G,C]
GCTAGATCGAGGTGGTTGGCGACTCCATTTCACCGCAAGGCATTTAGGTGTTGCGATCGTGCTTATCGACTTGTCAAAAAAGTTGCCAACACGATTTTTG

Reverse complement sequence

CAAAAATCGTGTTGGCAACTTTTTTGACAAGTCGATAAGCACGATCGCAACACCTAAATGCCTTGCGGTGAAATGGAGTCGCCAACCACCTCGATCTAGC[T/C,G]
AAACGGCCAAATCAAGATGGGTTTTGTAGAAAAACAGCTAAACCGGCTAGCAGAGCCGATTTAGAGATCAAAACCAGCCTCTAGGCCGATTTAGATCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 0.10% 4.49% 49.32% C: 0.06%
All Indica  2759 24.50% 0.10% 5.58% 69.63% C: 0.11%
All Japonica  1512 86.00% 0.10% 2.65% 11.31% NA
Aus  269 21.20% 0.00% 6.32% 72.49% NA
Indica I  595 46.70% 0.00% 2.02% 51.26% NA
Indica II  465 22.80% 0.00% 4.73% 72.47% NA
Indica III  913 5.30% 0.30% 8.65% 85.43% C: 0.33%
Indica Intermediate  786 31.20% 0.10% 5.22% 63.49% NA
Temperate Japonica  767 78.90% 0.10% 4.30% 16.69% NA
Tropical Japonica  504 97.00% 0.00% 0.00% 2.98% NA
Japonica Intermediate  241 85.50% 0.00% 2.90% 11.62% NA
VI/Aromatic  96 90.60% 0.00% 1.04% 8.33% NA
Intermediate  90 60.00% 0.00% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110030990 A -> DEL N N silent_mutation Average:12.497; most accessible tissue: Callus, score: 26.238 N N N N
vg1110030990 A -> G LOC_Os11g17890.1 upstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:12.497; most accessible tissue: Callus, score: 26.238 N N N N
vg1110030990 A -> G LOC_Os11g17880-LOC_Os11g17890 intergenic_region ; MODIFIER silent_mutation Average:12.497; most accessible tissue: Callus, score: 26.238 N N N N
vg1110030990 A -> C LOC_Os11g17890.1 upstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:12.497; most accessible tissue: Callus, score: 26.238 N N N N
vg1110030990 A -> C LOC_Os11g17880-LOC_Os11g17890 intergenic_region ; MODIFIER silent_mutation Average:12.497; most accessible tissue: Callus, score: 26.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110030990 5.15E-06 4.47E-07 mr1201 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990 NA 1.28E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990 NA 9.00E-08 mr1382 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990 NA 2.71E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990 NA 2.77E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990 NA 3.56E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251