Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1109851321:

Variant ID: vg1109851321 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9851321
Reference Allele: A	Alternative Allele: T,G
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCACACATAAAGTACTATTTATGTTTTATCATCTAATAGCAATAAAAATAATAATCATAAAAAATTTTCAAATAAGACGGACGGTCAAACGTTGAACAT[A/T,G]
AATAGTGCAAAACTGCACTTATTTTGGGACGGAGGGAGTAGAAATTTTTCAGATCCCCTTGTTACATGGCCCTAGGGGACTACTTATAGCCCTATTACAG

Reverse complement sequence

CTGTAATAGGGCTATAAGTAGTCCCCTAGGGCCATGTAACAAGGGGATCTGAAAAATTTCTACTCCCTCCGTCCCAAAATAAGTGCAGTTTTGCACTATT[T/A,C]
ATGTTCAACGTTTGACCGTCCGTCTTATTTGAAAATTTTTTATGATTATTATTTTTATTGCTATTAGATGATAAAACATAAATAGTACTTTATGTGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	2.60%	5.90%	18.26%	G: 1.99%
All Indica	2759	55.70%	4.50%	9.03%	28.02%	G: 2.75%
All Japonica	1512	97.20%	0.00%	0.13%	1.92%	G: 0.79%
Aus	269	85.90%	0.00%	5.20%	8.18%	G: 0.74%
Indica I	595	39.00%	0.00%	13.28%	42.02%	G: 5.71%
Indica II	465	61.70%	0.90%	13.76%	20.43%	G: 3.23%
Indica III	913	55.40%	9.50%	5.91%	27.05%	G: 2.08%
Indica Intermediate	786	65.30%	4.10%	6.62%	23.03%	G: 1.02%
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	96.00%	0.00%	0.20%	1.39%	G: 2.38%
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	72.90%	0.00%	1.04%	26.04%	NA
Intermediate	90	65.60%	0.00%	14.44%	15.56%	G: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109851321	A -> T	LOC_Os11g17660.1	downstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:48.702; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1109851321	A -> T	LOC_Os11g17650.1	intron_variant ; MODIFIER	silent_mutation	Average:48.702; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1109851321	A -> DEL	N	N	silent_mutation	Average:48.702; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1109851321	A -> G	LOC_Os11g17660.1	downstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:48.702; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1109851321	A -> G	LOC_Os11g17650.1	intron_variant ; MODIFIER	silent_mutation	Average:48.702; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109851321	3.41E-06	NA	mr1125	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251