Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109793060:

Variant ID: vg1109793060 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9793060
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ACATAATTGCTTACATATTTTGTTTTAATTTTTAAATTGCTAAATTTTGCCTCATATGCCACGTCAGATAAAAACCGAGTCAAATTAGCCACGTAGGCGC[C/T]
ATGTCAGCTAAAACAGTTGTCCAAACCTCCATGGTACTTATATTGCACCGGTTTTGACAGAGGGATCCGTTGTATCTGGTTTTCCAGTTGAAGGACGAAA

Reverse complement sequence

TTTCGTCCTTCAACTGGAAAACCAGATACAACGGATCCCTCTGTCAAAACCGGTGCAATATAAGTACCATGGAGGTTTGGACAACTGTTTTAGCTGACAT[G/A]
GCGCCTACGTGGCTAATTTGACTCGGTTTTTATCTGACGTGGCATATGAGGCAAAATTTAGCAATTTAAAAATTAAAACAAAATATGTAAGCAATTATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	11.30%	0.04%	0.00%	NA
All Indica	2759	81.60%	18.30%	0.07%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.40%	7.60%	0.00%	0.00%	NA
Indica II	465	48.80%	50.80%	0.43%	0.00%	NA
Indica III	913	93.90%	6.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.60%	21.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109793060	C -> T	LOC_Os11g17580.1	upstream_gene_variant ; 4346.0bp to feature; MODIFIER	silent_mutation	Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27	N	N	N	N
vg1109793060	C -> T	LOC_Os11g17600.1	upstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27	N	N	N	N
vg1109793060	C -> T	LOC_Os11g17600.3	upstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27	N	N	N	N
vg1109793060	C -> T	LOC_Os11g17600.2	upstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27	N	N	N	N
vg1109793060	C -> T	LOC_Os11g17580-LOC_Os11g17600	intergenic_region ; MODIFIER	silent_mutation	Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109793060	NA	2.66E-06	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	1.72E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	3.57E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	3.84E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	1.81E-06	NA	mr1097_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	8.89E-08	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	1.70E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	5.09E-06	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060	NA	2.95E-10	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251