\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109793060:

Variant ID: vg1109793060 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9793060
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAATTGCTTACATATTTTGTTTTAATTTTTAAATTGCTAAATTTTGCCTCATATGCCACGTCAGATAAAAACCGAGTCAAATTAGCCACGTAGGCGC[C/T]
ATGTCAGCTAAAACAGTTGTCCAAACCTCCATGGTACTTATATTGCACCGGTTTTGACAGAGGGATCCGTTGTATCTGGTTTTCCAGTTGAAGGACGAAA

Reverse complement sequence

TTTCGTCCTTCAACTGGAAAACCAGATACAACGGATCCCTCTGTCAAAACCGGTGCAATATAAGTACCATGGAGGTTTGGACAACTGTTTTAGCTGACAT[G/A]
GCGCCTACGTGGCTAATTTGACTCGGTTTTTATCTGACGTGGCATATGAGGCAAAATTTAGCAATTTAAAAATTAAAACAAAATATGTAAGCAATTATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.30% 0.04% 0.00% NA
All Indica  2759 81.60% 18.30% 0.07% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 48.80% 50.80% 0.43% 0.00% NA
Indica III  913 93.90% 6.10% 0.00% 0.00% NA
Indica Intermediate  786 78.60% 21.40% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109793060 C -> T LOC_Os11g17580.1 upstream_gene_variant ; 4346.0bp to feature; MODIFIER silent_mutation Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg1109793060 C -> T LOC_Os11g17600.1 upstream_gene_variant ; 1848.0bp to feature; MODIFIER silent_mutation Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg1109793060 C -> T LOC_Os11g17600.3 upstream_gene_variant ; 1848.0bp to feature; MODIFIER silent_mutation Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg1109793060 C -> T LOC_Os11g17600.2 upstream_gene_variant ; 1848.0bp to feature; MODIFIER silent_mutation Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg1109793060 C -> T LOC_Os11g17580-LOC_Os11g17600 intergenic_region ; MODIFIER silent_mutation Average:79.692; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109793060 NA 2.66E-06 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 1.72E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 3.57E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 3.84E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 1.81E-06 NA mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 8.89E-08 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 1.70E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 5.09E-06 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109793060 NA 2.95E-10 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251