| Variant ID: vg1109729286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9729286 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 105. )
CCACACGTTCCACCAGGTTGTTATCAAAGCACCCAAGTTCTGTCTTCTAATCTCTTTTGGTGTAATTTTGCATAAATCGATCCACCAATCTTCAATCGTG[G/A]
GCGCCGAATTTGGGGGAGATGTCGTTAAGTTCAACCAGCCACTCACAAGGTAACCTTGCTGGTATGCCATTTTCTCCATTTTTAATTATTTCTTTCTTTT
AAAAGAAAGAAATAATTAAAAATGGAGAAAATGGCATACCAGCAAGGTTACCTTGTGAGTGGCTGGTTGAACTTAACGACATCTCCCCCAAATTCGGCGC[C/T]
CACGATTGAAGATTGGTGGATCGATTTATGCAAAATTACACCAAAAGAGATTAGAAGACAGAACTTGGGTGCTTTGATAACAACCTGGTGGAACGTGTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 49.30% | 0.40% | 0.06% | NA |
| All Indica | 2759 | 74.40% | 25.00% | 0.47% | 0.11% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 86.60% | 12.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 38.30% | 60.60% | 0.86% | 0.22% | NA |
| Indica III | 913 | 90.40% | 9.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 68.10% | 31.00% | 0.64% | 0.25% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 92.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 65.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109729286 | G -> A | LOC_Os11g17440.1 | upstream_gene_variant ; 1199.0bp to feature; MODIFIER | silent_mutation | Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| vg1109729286 | G -> A | LOC_Os11g17450.1 | downstream_gene_variant ; 145.0bp to feature; MODIFIER | silent_mutation | Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| vg1109729286 | G -> A | LOC_Os11g17460.1 | downstream_gene_variant ; 4101.0bp to feature; MODIFIER | silent_mutation | Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| vg1109729286 | G -> A | LOC_Os11g17440-LOC_Os11g17450 | intergenic_region ; MODIFIER | silent_mutation | Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| vg1109729286 | G -> DEL | N | N | silent_mutation | Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109729286 | NA | 2.37E-12 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 1.74E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 9.22E-07 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 3.82E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 1.61E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 8.94E-13 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | NA | 8.04E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | 1.92E-07 | 3.29E-09 | mr1092_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | 3.08E-08 | 9.96E-18 | mr1097_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | 1.24E-09 | 1.45E-12 | mr1097_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | 9.12E-06 | 6.51E-09 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109729286 | 4.33E-07 | 3.94E-13 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |