\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109729286:

Variant ID: vg1109729286 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9729286
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CCACACGTTCCACCAGGTTGTTATCAAAGCACCCAAGTTCTGTCTTCTAATCTCTTTTGGTGTAATTTTGCATAAATCGATCCACCAATCTTCAATCGTG[G/A]
GCGCCGAATTTGGGGGAGATGTCGTTAAGTTCAACCAGCCACTCACAAGGTAACCTTGCTGGTATGCCATTTTCTCCATTTTTAATTATTTCTTTCTTTT

Reverse complement sequence

AAAAGAAAGAAATAATTAAAAATGGAGAAAATGGCATACCAGCAAGGTTACCTTGTGAGTGGCTGGTTGAACTTAACGACATCTCCCCCAAATTCGGCGC[C/T]
CACGATTGAAGATTGGTGGATCGATTTATGCAAAATTACACCAAAAGAGATTAGAAGACAGAACTTGGGTGCTTTGATAACAACCTGGTGGAACGTGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 49.30% 0.40% 0.06% NA
All Indica  2759 74.40% 25.00% 0.47% 0.11% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 95.20% 4.50% 0.37% 0.00% NA
Indica I  595 86.60% 12.90% 0.50% 0.00% NA
Indica II  465 38.30% 60.60% 0.86% 0.22% NA
Indica III  913 90.40% 9.50% 0.11% 0.00% NA
Indica Intermediate  786 68.10% 31.00% 0.64% 0.25% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 92.70% 2.08% 0.00% NA
Intermediate  90 31.10% 65.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109729286 G -> A LOC_Os11g17440.1 upstream_gene_variant ; 1199.0bp to feature; MODIFIER silent_mutation Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1109729286 G -> A LOC_Os11g17450.1 downstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1109729286 G -> A LOC_Os11g17460.1 downstream_gene_variant ; 4101.0bp to feature; MODIFIER silent_mutation Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1109729286 G -> A LOC_Os11g17440-LOC_Os11g17450 intergenic_region ; MODIFIER silent_mutation Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg1109729286 G -> DEL N N silent_mutation Average:73.228; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109729286 NA 2.37E-12 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 1.74E-06 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 9.22E-07 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 3.82E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 1.61E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 8.94E-13 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 NA 8.04E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 1.92E-07 3.29E-09 mr1092_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 3.08E-08 9.96E-18 mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 1.24E-09 1.45E-12 mr1097_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 9.12E-06 6.51E-09 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109729286 4.33E-07 3.94E-13 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251