\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109703916:

Variant ID: vg1109703916 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9703916
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAAGAGAAGTACAACATTAATATTAGTTCAGAACTTCAAAAATTGTTAATAAGAATTGTTTGTTGGATTATTTTATAATTACTAATTGTATGAGTAAT[T/G]
ATATGTCATTATTTTTTATGCTTGTCGAAAGAGTTTTTAATTATTTTATCATTATTGTTTGACTGTTATTATTGTACGAAAATTTATTTATGTACGATTT

Reverse complement sequence

AAATCGTACATAAATAAATTTTCGTACAATAATAACAGTCAAACAATAATGATAAAATAATTAAAAACTCTTTCGACAAGCATAAAAAATAATGACATAT[A/C]
ATTACTCATACAATTAGTAATTATAAAATAATCCAACAAACAATTCTTATTAACAATTTTTGAAGTTCTGAACTAATATTAATGTTGTACTTCTCTTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 32.70% 0.17% 6.07% NA
All Indica  2759 88.50% 1.60% 0.18% 9.71% NA
All Japonica  1512 3.60% 95.40% 0.00% 1.06% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 91.90% 0.80% 0.17% 7.06% NA
Indica II  465 86.70% 1.90% 0.00% 11.40% NA
Indica III  913 94.20% 0.70% 0.00% 5.15% NA
Indica Intermediate  786 80.40% 3.10% 0.51% 16.03% NA
Temperate Japonica  767 1.40% 96.60% 0.00% 1.96% NA
Tropical Japonica  504 6.30% 93.50% 0.00% 0.20% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 19.80% 0.00% 1.04% NA
Intermediate  90 60.00% 34.40% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109703916 T -> DEL N N silent_mutation Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1109703916 T -> G LOC_Os11g17390.1 upstream_gene_variant ; 2379.0bp to feature; MODIFIER silent_mutation Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1109703916 T -> G LOC_Os11g17400.1 upstream_gene_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1109703916 T -> G LOC_Os11g17390-LOC_Os11g17400 intergenic_region ; MODIFIER silent_mutation Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109703916 NA 4.12E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109703916 NA 1.14E-11 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109703916 NA 4.68E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109703916 2.55E-06 1.55E-08 mr1723_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109703916 NA 4.87E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251