\
| Variant ID: vg1109703916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9703916 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTAAGAGAAGTACAACATTAATATTAGTTCAGAACTTCAAAAATTGTTAATAAGAATTGTTTGTTGGATTATTTTATAATTACTAATTGTATGAGTAAT[T/G]
ATATGTCATTATTTTTTATGCTTGTCGAAAGAGTTTTTAATTATTTTATCATTATTGTTTGACTGTTATTATTGTACGAAAATTTATTTATGTACGATTT
AAATCGTACATAAATAAATTTTCGTACAATAATAACAGTCAAACAATAATGATAAAATAATTAAAAACTCTTTCGACAAGCATAAAAAATAATGACATAT[A/C]
ATTACTCATACAATTAGTAATTATAAAATAATCCAACAAACAATTCTTATTAACAATTTTTGAAGTTCTGAACTAATATTAATGTTGTACTTCTCTTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 32.70% | 0.17% | 6.07% | NA |
| All Indica | 2759 | 88.50% | 1.60% | 0.18% | 9.71% | NA |
| All Japonica | 1512 | 3.60% | 95.40% | 0.00% | 1.06% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.90% | 0.80% | 0.17% | 7.06% | NA |
| Indica II | 465 | 86.70% | 1.90% | 0.00% | 11.40% | NA |
| Indica III | 913 | 94.20% | 0.70% | 0.00% | 5.15% | NA |
| Indica Intermediate | 786 | 80.40% | 3.10% | 0.51% | 16.03% | NA |
| Temperate Japonica | 767 | 1.40% | 96.60% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 6.30% | 93.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 60.00% | 34.40% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109703916 | T -> DEL | N | N | silent_mutation | Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1109703916 | T -> G | LOC_Os11g17390.1 | upstream_gene_variant ; 2379.0bp to feature; MODIFIER | silent_mutation | Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1109703916 | T -> G | LOC_Os11g17400.1 | upstream_gene_variant ; 119.0bp to feature; MODIFIER | silent_mutation | Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1109703916 | T -> G | LOC_Os11g17390-LOC_Os11g17400 | intergenic_region ; MODIFIER | silent_mutation | Average:17.159; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109703916 | NA | 4.12E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109703916 | NA | 1.14E-11 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109703916 | NA | 4.68E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109703916 | 2.55E-06 | 1.55E-08 | mr1723_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109703916 | NA | 4.87E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |