Variant ID: vg1109563062 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 9563062 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGTCTATAGGAAGCTCAATGAGTTTTTATACTAAAAACCAATTAAATTTCCTATAAATGCTCTCGGCCGCCACATGGCTTCTACAAATGCTTCTAGATC[G/A]
TCACGTTGTATTCTATAATCACACCGTCAAATTTCTTTTGAATTGATGGACCTGTTGATTTTAACCATTAGATCACCATCTCGAAGAAAATAAATCTGGT
ACCAGATTTATTTTCTTCGAGATGGTGATCTAATGGTTAAAATCAACAGGTCCATCAATTCAAAAGAAATTTGACGGTGTGATTATAGAATACAACGTGA[C/T]
GATCTAGAAGCATTTGTAGAAGCCATGTGGCGGCCGAGAGCATTTATAGGAAATTTAATTGGTTTTTAGTATAAAAACTCATTGAGCTTCCTATAGACAC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.40% | 32.50% | 0.76% | 2.35% | NA |
All Indica | 2759 | 96.40% | 2.80% | 0.25% | 0.58% | NA |
All Japonica | 1512 | 3.50% | 92.70% | 1.79% | 2.05% | NA |
Aus | 269 | 96.70% | 3.00% | 0.00% | 0.37% | NA |
Indica I | 595 | 93.60% | 3.50% | 0.34% | 2.52% | NA |
Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 93.90% | 5.70% | 0.25% | 0.13% | NA |
Temperate Japonica | 767 | 3.40% | 92.00% | 2.74% | 1.83% | NA |
Tropical Japonica | 504 | 4.40% | 93.30% | 0.60% | 1.79% | NA |
Japonica Intermediate | 241 | 2.10% | 93.40% | 1.24% | 3.32% | NA |
VI/Aromatic | 96 | 20.80% | 17.70% | 0.00% | 61.46% | NA |
Intermediate | 90 | 56.70% | 36.70% | 2.22% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1109563062 | G -> A | LOC_Os11g17190.1 | downstream_gene_variant ; 4824.0bp to feature; MODIFIER | silent_mutation | Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 | N | N | N | N |
vg1109563062 | G -> A | LOC_Os11g17180-LOC_Os11g17190 | intergenic_region ; MODIFIER | silent_mutation | Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 | N | N | N | N |
vg1109563062 | G -> DEL | N | N | silent_mutation | Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1109563062 | NA | 4.96E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | NA | 5.79E-17 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | NA | 2.49E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | NA | 8.85E-18 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | NA | 6.14E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | 2.20E-06 | NA | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | 7.62E-07 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109563062 | 5.67E-06 | 4.13E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |