\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109563062:

Variant ID: vg1109563062 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9563062
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTCTATAGGAAGCTCAATGAGTTTTTATACTAAAAACCAATTAAATTTCCTATAAATGCTCTCGGCCGCCACATGGCTTCTACAAATGCTTCTAGATC[G/A]
TCACGTTGTATTCTATAATCACACCGTCAAATTTCTTTTGAATTGATGGACCTGTTGATTTTAACCATTAGATCACCATCTCGAAGAAAATAAATCTGGT

Reverse complement sequence

ACCAGATTTATTTTCTTCGAGATGGTGATCTAATGGTTAAAATCAACAGGTCCATCAATTCAAAAGAAATTTGACGGTGTGATTATAGAATACAACGTGA[C/T]
GATCTAGAAGCATTTGTAGAAGCCATGTGGCGGCCGAGAGCATTTATAGGAAATTTAATTGGTTTTTAGTATAAAAACTCATTGAGCTTCCTATAGACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 32.50% 0.76% 2.35% NA
All Indica  2759 96.40% 2.80% 0.25% 0.58% NA
All Japonica  1512 3.50% 92.70% 1.79% 2.05% NA
Aus  269 96.70% 3.00% 0.00% 0.37% NA
Indica I  595 93.60% 3.50% 0.34% 2.52% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 93.90% 5.70% 0.25% 0.13% NA
Temperate Japonica  767 3.40% 92.00% 2.74% 1.83% NA
Tropical Japonica  504 4.40% 93.30% 0.60% 1.79% NA
Japonica Intermediate  241 2.10% 93.40% 1.24% 3.32% NA
VI/Aromatic  96 20.80% 17.70% 0.00% 61.46% NA
Intermediate  90 56.70% 36.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109563062 G -> A LOC_Os11g17190.1 downstream_gene_variant ; 4824.0bp to feature; MODIFIER silent_mutation Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N
vg1109563062 G -> A LOC_Os11g17180-LOC_Os11g17190 intergenic_region ; MODIFIER silent_mutation Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N
vg1109563062 G -> DEL N N silent_mutation Average:34.129; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109563062 NA 4.96E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 NA 5.79E-17 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 NA 2.49E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 NA 8.85E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 NA 6.14E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 2.20E-06 NA mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 7.62E-07 NA mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109563062 5.67E-06 4.13E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251