\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109561136:

Variant ID: vg1109561136 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9561136
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTTTGTGTCCAGACAACATAAGCACCGCACGCGAAAATCCGATTTTTTTGTGCAGAAGCACCACCCACACACAAAAATAGCGATTTTCGCAACATCT[G/A]
GATGCGTACATGCCGCTCAGCCGCCTGCAAAAATCGGTTTTAAGCATAAGATAAAATGGTTTTTTTAAGTTGTGGTGTAGAGGTGAGCAGGAGGAATGAG

Reverse complement sequence

CTCATTCCTCCTGCTCACCTCTACACCACAACTTAAAAAAACCATTTTATCTTATGCTTAAAACCGATTTTTGCAGGCGGCTGAGCGGCATGTACGCATC[C/T]
AGATGTTGCGAAAATCGCTATTTTTGTGTGTGGGTGGTGCTTCTGCACAAAAAAATCGGATTTTCGCGTGCGGTGCTTATGTTGTCTGGACACAAAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.10% 0.19% 1.88% NA
All Indica  2759 82.90% 16.50% 0.07% 0.47% NA
All Japonica  1512 98.10% 0.70% 0.13% 1.12% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 69.60% 28.10% 0.34% 2.02% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 83.00% 17.00% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 16.30% 0.00% 0.13% NA
Temperate Japonica  767 99.10% 0.80% 0.00% 0.13% NA
Tropical Japonica  504 97.40% 0.60% 0.20% 1.79% NA
Japonica Intermediate  241 96.30% 0.40% 0.41% 2.90% NA
VI/Aromatic  96 37.50% 1.00% 4.17% 57.29% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109561136 G -> A LOC_Os11g17180.1 upstream_gene_variant ; 3354.0bp to feature; MODIFIER silent_mutation Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 N N N N
vg1109561136 G -> A LOC_Os11g17180-LOC_Os11g17190 intergenic_region ; MODIFIER silent_mutation Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 N N N N
vg1109561136 G -> DEL N N silent_mutation Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109561136 NA 9.08E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 1.40E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 5.46E-06 mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 1.03E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 8.99E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 8.05E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 3.66E-08 mr1759 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 1.63E-07 mr1759 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136 NA 4.07E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251