\
| Variant ID: vg1109561136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9561136 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )
TGTTTTTGTGTCCAGACAACATAAGCACCGCACGCGAAAATCCGATTTTTTTGTGCAGAAGCACCACCCACACACAAAAATAGCGATTTTCGCAACATCT[G/A]
GATGCGTACATGCCGCTCAGCCGCCTGCAAAAATCGGTTTTAAGCATAAGATAAAATGGTTTTTTTAAGTTGTGGTGTAGAGGTGAGCAGGAGGAATGAG
CTCATTCCTCCTGCTCACCTCTACACCACAACTTAAAAAAACCATTTTATCTTATGCTTAAAACCGATTTTTGCAGGCGGCTGAGCGGCATGTACGCATC[C/T]
AGATGTTGCGAAAATCGCTATTTTTGTGTGTGGGTGGTGCTTCTGCACAAAAAAATCGGATTTTCGCGTGCGGTGCTTATGTTGTCTGGACACAAAAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 10.10% | 0.19% | 1.88% | NA |
| All Indica | 2759 | 82.90% | 16.50% | 0.07% | 0.47% | NA |
| All Japonica | 1512 | 98.10% | 0.70% | 0.13% | 1.12% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 69.60% | 28.10% | 0.34% | 2.02% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.30% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 97.40% | 0.60% | 0.20% | 1.79% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.40% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 37.50% | 1.00% | 4.17% | 57.29% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109561136 | G -> A | LOC_Os11g17180.1 | upstream_gene_variant ; 3354.0bp to feature; MODIFIER | silent_mutation | Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 | N | N | N | N |
| vg1109561136 | G -> A | LOC_Os11g17180-LOC_Os11g17190 | intergenic_region ; MODIFIER | silent_mutation | Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 | N | N | N | N |
| vg1109561136 | G -> DEL | N | N | silent_mutation | Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109561136 | NA | 9.08E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 1.40E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 5.46E-06 | mr1214 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 1.03E-06 | mr1611 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 8.99E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 8.05E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 3.66E-08 | mr1759 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 1.63E-07 | mr1759 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109561136 | NA | 4.07E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |