Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1108802682:

Variant ID: vg1108802682 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8802682
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

AGATCAGAACAAAACTGATGCTAATGCCAGTAATACCATTGGACAACACACGCAGATAAGGGGGTGTTTGGGAACTAGGGACTAAATTTAGTCCCTCTCA[C/T]
AAAAATATAAGTCCCTATGGTAGGGACTTATACTTTTGTGAGAGTGACTAAAGTTTAGCTCCACTTTAATCCCTCCAACCAAACACCACTTAAGAGTTGA

Reverse complement sequence

TCAACTCTTAAGTGGTGTTTGGTTGGAGGGATTAAAGTGGAGCTAAACTTTAGTCACTCTCACAAAAGTATAAGTCCCTACCATAGGGACTTATATTTTT[G/A]
TGAGAGGGACTAAATTTAGTCCCTAGTTCCCAAACACCCCCTTATCTGCGTGTGTTGTCCAATGGTATTACTGGCATTAGCATCAGTTTTGTTCTGATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	0.40%	6.90%	36.33%	NA
All Indica	2759	35.00%	0.00%	10.33%	54.62%	NA
All Japonica	1512	91.30%	0.10%	0.60%	8.00%	NA
Aus	269	70.60%	0.00%	8.92%	20.45%	NA
Indica I	595	22.00%	0.00%	9.75%	68.24%	NA
Indica II	465	29.00%	0.00%	15.70%	55.27%	NA
Indica III	913	45.00%	0.00%	7.56%	47.43%	NA
Indica Intermediate	786	36.80%	0.10%	10.81%	52.29%	NA
Temperate Japonica	767	98.70%	0.00%	0.00%	1.30%	NA
Tropical Japonica	504	82.70%	0.20%	0.60%	16.47%	NA
Japonica Intermediate	241	85.90%	0.00%	2.49%	11.62%	NA
VI/Aromatic	96	76.00%	14.60%	3.12%	6.25%	NA
Intermediate	90	62.20%	1.10%	5.56%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108802682	C -> T	LOC_Os11g15520.1	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:52.158; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1108802682	C -> T	LOC_Os11g15540.1	upstream_gene_variant ; 2308.0bp to feature; MODIFIER	silent_mutation	Average:52.158; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1108802682	C -> T	LOC_Os11g15530.1	downstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:52.158; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1108802682	C -> T	LOC_Os11g15520-LOC_Os11g15530	intergenic_region ; MODIFIER	silent_mutation	Average:52.158; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1108802682	C -> DEL	N	N	silent_mutation	Average:52.158; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108802682	NA	6.24E-06	mr1027	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	4.83E-09	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	1.01E-06	3.27E-13	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	6.04E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	3.84E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	5.40E-14	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	7.81E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108802682	NA	1.85E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251