\
| Variant ID: vg1108799422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8799422 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 86. )
GATTATTAGATCCATTAAAATATAATCTCTCACTTCTAATATACCGTTTCTATATGAGAGAAAATACATCCAAAAGTGATAAAAAAAGATCGAAATAAAA[A/C]
AAGATAAAAAACCAAAAAAACAATTACAGATTGAAAAGAAAAATTAACAGCTAACATATAAAACGTCCAATCCGGCAATCTGCTCACCTCTCAAGCATGT
ACATGCTTGAGAGGTGAGCAGATTGCCGGATTGGACGTTTTATATGTTAGCTGTTAATTTTTCTTTTCAATCTGTAATTGTTTTTTTGGTTTTTTATCTT[T/G]
TTTTATTTCGATCTTTTTTTATCACTTTTGGATGTATTTTCTCTCATATAGAAACGGTATATTAGAAGTGAGAGATTATATTTTAATGGATCTAATAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 20.00% | 4.59% | 15.57% | NA |
| All Indica | 2759 | 35.00% | 33.10% | 6.71% | 25.19% | NA |
| All Japonica | 1512 | 96.80% | 1.40% | 0.26% | 1.52% | NA |
| Aus | 269 | 89.20% | 0.00% | 9.67% | 1.12% | NA |
| Indica I | 595 | 13.40% | 65.50% | 8.24% | 12.77% | NA |
| Indica II | 465 | 34.00% | 13.30% | 6.45% | 46.24% | NA |
| Indica III | 913 | 47.00% | 26.80% | 5.91% | 20.26% | NA |
| Indica Intermediate | 786 | 38.00% | 27.50% | 6.62% | 27.86% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 1.20% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.40% | 1.24% | 4.56% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 13.30% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108799422 | A -> DEL | N | N | silent_mutation | Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1108799422 | A -> C | LOC_Os11g15520.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1108799422 | A -> C | LOC_Os11g15530.1 | downstream_gene_variant ; 3943.0bp to feature; MODIFIER | silent_mutation | Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1108799422 | A -> C | LOC_Os11g15520-LOC_Os11g15530 | intergenic_region ; MODIFIER | silent_mutation | Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108799422 | NA | 4.25E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | 1.97E-06 | 1.96E-06 | mr1394 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | NA | 7.60E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | 5.91E-06 | NA | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | 1.49E-06 | NA | mr1907 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | 4.29E-06 | NA | mr1907 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108799422 | NA | 2.81E-23 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |