Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1108799422:

Variant ID: vg1108799422 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8799422
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GATTATTAGATCCATTAAAATATAATCTCTCACTTCTAATATACCGTTTCTATATGAGAGAAAATACATCCAAAAGTGATAAAAAAAGATCGAAATAAAA[A/C]
AAGATAAAAAACCAAAAAAACAATTACAGATTGAAAAGAAAAATTAACAGCTAACATATAAAACGTCCAATCCGGCAATCTGCTCACCTCTCAAGCATGT

Reverse complement sequence

ACATGCTTGAGAGGTGAGCAGATTGCCGGATTGGACGTTTTATATGTTAGCTGTTAATTTTTCTTTTCAATCTGTAATTGTTTTTTTGGTTTTTTATCTT[T/G]
TTTTATTTCGATCTTTTTTTATCACTTTTGGATGTATTTTCTCTCATATAGAAACGGTATATTAGAAGTGAGAGATTATATTTTAATGGATCTAATAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	20.00%	4.59%	15.57%	NA
All Indica	2759	35.00%	33.10%	6.71%	25.19%	NA
All Japonica	1512	96.80%	1.40%	0.26%	1.52%	NA
Aus	269	89.20%	0.00%	9.67%	1.12%	NA
Indica I	595	13.40%	65.50%	8.24%	12.77%	NA
Indica II	465	34.00%	13.30%	6.45%	46.24%	NA
Indica III	913	47.00%	26.80%	5.91%	20.26%	NA
Indica Intermediate	786	38.00%	27.50%	6.62%	27.86%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	1.20%	0.20%	2.38%	NA
Japonica Intermediate	241	93.80%	0.40%	1.24%	4.56%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	68.90%	13.30%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108799422	A -> DEL	N	N	silent_mutation	Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg1108799422	A -> C	LOC_Os11g15520.1	upstream_gene_variant ; 1273.0bp to feature; MODIFIER	silent_mutation	Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg1108799422	A -> C	LOC_Os11g15530.1	downstream_gene_variant ; 3943.0bp to feature; MODIFIER	silent_mutation	Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg1108799422	A -> C	LOC_Os11g15520-LOC_Os11g15530	intergenic_region ; MODIFIER	silent_mutation	Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108799422	NA	4.25E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	1.97E-06	1.96E-06	mr1394	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	NA	7.60E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	5.91E-06	NA	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	1.49E-06	NA	mr1907	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	4.29E-06	NA	mr1907	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422	NA	2.81E-23	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251