\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108799422:

Variant ID: vg1108799422 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8799422
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GATTATTAGATCCATTAAAATATAATCTCTCACTTCTAATATACCGTTTCTATATGAGAGAAAATACATCCAAAAGTGATAAAAAAAGATCGAAATAAAA[A/C]
AAGATAAAAAACCAAAAAAACAATTACAGATTGAAAAGAAAAATTAACAGCTAACATATAAAACGTCCAATCCGGCAATCTGCTCACCTCTCAAGCATGT

Reverse complement sequence

ACATGCTTGAGAGGTGAGCAGATTGCCGGATTGGACGTTTTATATGTTAGCTGTTAATTTTTCTTTTCAATCTGTAATTGTTTTTTTGGTTTTTTATCTT[T/G]
TTTTATTTCGATCTTTTTTTATCACTTTTGGATGTATTTTCTCTCATATAGAAACGGTATATTAGAAGTGAGAGATTATATTTTAATGGATCTAATAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 20.00% 4.59% 15.57% NA
All Indica  2759 35.00% 33.10% 6.71% 25.19% NA
All Japonica  1512 96.80% 1.40% 0.26% 1.52% NA
Aus  269 89.20% 0.00% 9.67% 1.12% NA
Indica I  595 13.40% 65.50% 8.24% 12.77% NA
Indica II  465 34.00% 13.30% 6.45% 46.24% NA
Indica III  913 47.00% 26.80% 5.91% 20.26% NA
Indica Intermediate  786 38.00% 27.50% 6.62% 27.86% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 1.20% 0.20% 2.38% NA
Japonica Intermediate  241 93.80% 0.40% 1.24% 4.56% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 68.90% 13.30% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108799422 A -> DEL N N silent_mutation Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1108799422 A -> C LOC_Os11g15520.1 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1108799422 A -> C LOC_Os11g15530.1 downstream_gene_variant ; 3943.0bp to feature; MODIFIER silent_mutation Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1108799422 A -> C LOC_Os11g15520-LOC_Os11g15530 intergenic_region ; MODIFIER silent_mutation Average:14.606; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108799422 NA 4.25E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 1.97E-06 1.96E-06 mr1394 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 NA 7.60E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 5.91E-06 NA mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 1.49E-06 NA mr1907 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 4.29E-06 NA mr1907 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108799422 NA 2.81E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251