\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108676355:

Variant ID: vg1108676355 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8676355
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGATCCACACCTCCCAAGGTGGGTAGCACCAGATCCCTTGGTCTTGTAGCCTCTGCCGCTCCCATTTGCCACCGCCATCGCTGCTCCCCACTATTGT[C/G]
GCTGAAGCTAGATTCGGACAACACACACCACTGTGCACATTGGCCGGATCCAATGAGGGGAGGGGAAGGAGGTTGTGCGCGGCAAGCTCAAGGAAGCAGT

Reverse complement sequence

ACTGCTTCCTTGAGCTTGCCGCGCACAACCTCCTTCCCCTCCCCTCATTGGATCCGGCCAATGTGCACAGTGGTGTGTGTTGTCCGAATCTAGCTTCAGC[G/C]
ACAATAGTGGGGAGCAGCGATGGCGGTGGCAAATGGGAGCGGCAGAGGCTACAAGACCAAGGGATCTGGTGCTACCCACCTTGGGAGGTGTGGATCTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 2.70% 1.71% 15.45% NA
All Indica  2759 68.20% 4.50% 2.83% 24.43% NA
All Japonica  1512 97.80% 0.00% 0.00% 2.18% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 92.40% 0.20% 1.51% 5.88% NA
Indica II  465 35.90% 20.20% 7.31% 36.56% NA
Indica III  913 68.70% 0.00% 1.20% 30.12% NA
Indica Intermediate  786 68.60% 3.70% 3.05% 24.68% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 0.00% 0.00% 1.79% NA
Japonica Intermediate  241 90.00% 0.00% 0.00% 9.96% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 83.30% 2.20% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108676355 C -> DEL N N silent_mutation Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177 N N N N
vg1108676355 C -> G LOC_Os11g15340.2 upstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177 N N N N
vg1108676355 C -> G LOC_Os11g15320-LOC_Os11g15340 intergenic_region ; MODIFIER silent_mutation Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1108676355 C G 0.0 0.03 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108676355 NA 6.13E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 5.97E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 5.01E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 6.66E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 1.44E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 2.67E-10 mr1322_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 1.10E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 1.08E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 1.77E-07 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 1.77E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 3.16E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 4.51E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355 NA 2.13E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251