\
| Variant ID: vg1108425600 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8425600 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTCCTCCCCTTCGCAATGGCAGGGCTGGTTCCGCCATTTTCTTCTTTCTTTATGGATGTTCTGGATTTCTACGATCTCCAGATGGCGCACCTCACCCCT[A/C]
ATGCAGTGATGACATTGGCCATCTTCACGCACCTGTGCGAGATGTTCATTGGGGTGCGCCCATCTCTTCGGCTGTTCCGGTGGTTCTTCACCGTGCAGTC
GACTGCACGGTGAAGAACCACCGGAACAGCCGAAGAGATGGGCGCACCCCAATGAACATCTCGCACAGGTGCGTGAAGATGGCCAATGTCATCACTGCAT[T/G]
AGGGGTGAGGTGCGCCATCTGGAGATCGTAGAAATCCAGAACATCCATAAAGAAAGAAGAAAATGGCGGAACCAGCCCTGCCATTGCGAAGGGGAGGAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.20% | 4.10% | 30.62% | 19.09% | NA |
| All Indica | 2759 | 21.50% | 0.60% | 48.89% | 29.07% | NA |
| All Japonica | 1512 | 92.10% | 0.00% | 3.11% | 4.83% | NA |
| Aus | 269 | 25.30% | 61.30% | 10.04% | 3.35% | NA |
| Indica I | 595 | 10.10% | 0.20% | 42.52% | 47.23% | NA |
| Indica II | 465 | 16.10% | 0.20% | 55.27% | 28.39% | NA |
| Indica III | 913 | 28.40% | 0.30% | 53.89% | 17.42% | NA |
| Indica Intermediate | 786 | 25.20% | 1.40% | 44.15% | 29.26% | NA |
| Temperate Japonica | 767 | 94.30% | 0.00% | 1.30% | 4.43% | NA |
| Tropical Japonica | 504 | 90.90% | 0.00% | 4.56% | 4.56% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.00% | 5.81% | 6.64% | NA |
| VI/Aromatic | 96 | 88.50% | 9.40% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 25.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108425600 | A -> DEL | LOC_Os11g14960.1 | N | frameshift_variant | Average:13.59; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg1108425600 | A -> C | LOC_Os11g14960.1 | missense_variant ; p.Asn92His; MODERATE | nonsynonymous_codon | Average:13.59; most accessible tissue: Minghui63 root, score: 21.615 | probably damaging |
2.743 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108425600 | NA | 2.39E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 8.77E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 2.31E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 5.74E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 2.11E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 4.13E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 6.65E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 1.87E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 2.11E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 9.05E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 7.53E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | NA | 2.06E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108425600 | 3.39E-06 | NA | mr1922_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |