Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107749329:

Variant ID: vg1107749329 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7749329
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAATGTGAGGATGATAATTTGACACTTATATATTGAGTTTTATAATATACTACATACATCTCAATACTACCCACCTTCCTCCCGGCCAACCACAAGTA[G/A]
ATCGTGGCTCAAGAGCGACACCTAACTATCTATTAGCTCTCAACCTCTAAGAGTAAAAAGAAGCATGGTTCTCTTAGGATGAAGCAAGTAGGAATACTCA

Reverse complement sequence

TGAGTATTCCTACTTGCTTCATCCTAAGAGAACCATGCTTCTTTTTACTCTTAGAGGTTGAGAGCTAATAGATAGTTAGGTGTCGCTCTTGAGCCACGAT[C/T]
TACTTGTGGTTGGCCGGGAGGAAGGTGGGTAGTATTGAGATGTATGTAGTATATTATAAAACTCAATATATAAGTGTCAAATTATCATCCTCACATTATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	43.60%	0.21%	0.13%	NA
All Indica	2759	89.90%	9.70%	0.25%	0.11%	NA
All Japonica	1512	8.40%	91.50%	0.00%	0.13%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	87.20%	12.40%	0.17%	0.17%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	91.80%	8.00%	0.11%	0.11%	NA
Indica Intermediate	786	85.80%	13.60%	0.51%	0.13%	NA
Temperate Japonica	767	3.70%	96.20%	0.00%	0.13%	NA
Tropical Japonica	504	11.90%	88.10%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.40%	0.00%	0.41%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	40.00%	55.60%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107749329	G -> A	LOC_Os11g13970.1	upstream_gene_variant ; 1913.0bp to feature; MODIFIER	silent_mutation	Average:56.797; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg1107749329	G -> A	LOC_Os11g13980.1	downstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:56.797; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg1107749329	G -> A	LOC_Os11g13990.1	downstream_gene_variant ; 3996.0bp to feature; MODIFIER	silent_mutation	Average:56.797; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg1107749329	G -> A	LOC_Os11g13970-LOC_Os11g13980	intergenic_region ; MODIFIER	silent_mutation	Average:56.797; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N
vg1107749329	G -> DEL	N	N	silent_mutation	Average:56.797; most accessible tissue: Minghui63 root, score: 85.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107749329	NA	8.44E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.48E-34	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	3.24E-07	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	4.16E-32	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	1.74E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	3.25E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.78E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	4.05E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	1.13E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	3.52E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	1.60E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.56E-51	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	3.15E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	8.04E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.00E-22	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.47E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	9.84E-15	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	3.98E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	1.30E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	1.10E-06	8.11E-07	mr1425_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	2.36E-13	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	7.03E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107749329	NA	6.78E-08	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251