\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107669372:

Variant ID: vg1107669372 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7669372
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACATTCCAAATACTACTTGTGCAACTGAGAGAAAAATCATAATTTCGTAGGCCATTTATGAATTTGAAAAAAATGCTGCATTTAGAACAACTCTAAAT[A/T]
TAAGATTGAAAAGTAAACGGTTTGAATTTTTAGTTCAGGCAATGTCATGTTTTAAAATTTTTAGTTTATCTACAAAATCTCATAAAAAATGTTAATGGGG

Reverse complement sequence

CCCCATTAACATTTTTTATGAGATTTTGTAGATAAACTAAAAATTTTAAAACATGACATTGCCTGAACTAAAAATTCAAACCGTTTACTTTTCAATCTTA[T/A]
ATTTAGAGTTGTTCTAAATGCAGCATTTTTTTCAAATTCATAAATGGCCTACGAAATTATGATTTTTCTCTCAGTTGCACAAGTAGTATTTGGAATGTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 39.10% 0.47% 0.02% NA
All Indica  2759 95.70% 3.90% 0.36% 0.04% NA
All Japonica  1512 8.20% 91.10% 0.66% 0.00% NA
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 98.10% 1.80% 0.11% 0.00% NA
Indica Intermediate  786 89.30% 9.80% 0.76% 0.13% NA
Temperate Japonica  767 3.80% 95.80% 0.39% 0.00% NA
Tropical Japonica  504 10.70% 88.50% 0.79% 0.00% NA
Japonica Intermediate  241 17.00% 81.70% 1.24% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107669372 A -> T LOC_Os11g13890-LOC_Os11g13900 intergenic_region ; MODIFIER silent_mutation Average:24.382; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1107669372 A -> DEL N N silent_mutation Average:24.382; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107669372 NA 7.60E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.86E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.99E-31 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 8.40E-06 8.40E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 6.99E-07 1.83E-34 mr1086 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 4.72E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.15E-61 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 6.54E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.03E-35 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.05E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 3.85E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.65E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 4.41E-36 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.26E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.10E-36 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 9.19E-07 1.72E-09 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 6.57E-07 5.73E-39 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.96E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.13E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.25E-62 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 8.51E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 6.48E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.49E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.61E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.72E-42 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 6.31E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 7.31E-42 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 7.60E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.50E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.19E-13 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 2.19E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.00E-33 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 4.89E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107669372 NA 1.14E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251