Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1107626177:

Variant ID: vg1107626177 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7626177
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TACGGACTTCGGATCAACTGATCACCATAGTGAGAGATTCTAGTCACATGTAGGTCGATGACCCAATTAATGATTTCTTATCCATTGTCCAGGTTTAAAT[T/G]
TATCCACTATTTTCATTTGATCCATTTGGATGGGTACGGAGATAAGAAAAAAAATTATGGCAATAGCGAAAAAAATGGTTCAAATGATGAGGGTGGAGCA

Reverse complement sequence

TGCTCCACCCTCATCATTTGAACCATTTTTTTCGCTATTGCCATAATTTTTTTTCTTATCTCCGTACCCATCCAAATGGATCAAATGAAAATAGTGGATA[A/C]
ATTTAAACCTGGACAATGGATAAGAAATCATTAATTGGGTCATCGACCTACATGTGACTAGAATCTCTCACTATGGTGATCAGTTGATCCGAAGTCCGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	9.50%	0.06%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.04%	0.00%	NA
All Japonica	1512	94.40%	5.50%	0.13%	0.00%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.70%	0.13%	0.00%	NA
Temperate Japonica	767	94.10%	5.60%	0.26%	0.00%	NA
Tropical Japonica	504	94.00%	6.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107626177	T -> G	LOC_Os11g13840.1	downstream_gene_variant ; 1491.0bp to feature; MODIFIER	silent_mutation	Average:63.762; most accessible tissue: Callus, score: 75.941	N	N	N	N
vg1107626177	T -> G	LOC_Os11g13830-LOC_Os11g13840	intergenic_region ; MODIFIER	silent_mutation	Average:63.762; most accessible tissue: Callus, score: 75.941	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107626177	NA	2.96E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	2.50E-08	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	9.76E-24	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	5.44E-07	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	5.73E-10	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.71E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	2.42E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.95E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.03E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	5.28E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	2.57E-12	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	3.37E-24	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.06E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.17E-09	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	3.04E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	3.77E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	2.71E-06	NA	mr1842	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	8.45E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	1.63E-18	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	9.40E-09	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107626177	NA	2.73E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251