\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107619278:

Variant ID: vg1107619278 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7619278
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGTAAATATAAAAAAAAAATTAAGTCACGCTTAAAAAGTCACAATAAAATAAATAAGTTTAAATAAGATGAATGATTAAACGTATAAAAAATCAAGGG[T/C]
GTTGTATATTAAAAAAAAGAGGTATATGTTTAAGGACTACAAGCCAATACTACTGCTAATCAATAGTGTCTAATGTTGGATTTATTCACTAACATGTTCT

Reverse complement sequence

AGAACATGTTAGTGAATAAATCCAACATTAGACACTATTGATTAGCAGTAGTATTGGCTTGTAGTCCTTAAACATATACCTCTTTTTTTTAATATACAAC[A/G]
CCCTTGATTTTTTATACGTTTAATCATTCATCTTATTTAAACTTATTTATTTTATTGTGACTTTTTAAGCGTGACTTAATTTTTTTTTTATATTTACACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 13.90% 0.17% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 80.50% 19.00% 0.53% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 69.10% 30.10% 0.78% 0.00% NA
Tropical Japonica  504 93.70% 6.20% 0.20% 0.00% NA
Japonica Intermediate  241 89.20% 10.40% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107619278 T -> C LOC_Os11g13830.1 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:65.023; most accessible tissue: Callus, score: 95.888 N N N N
vg1107619278 T -> C LOC_Os11g13820.1 downstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:65.023; most accessible tissue: Callus, score: 95.888 N N N N
vg1107619278 T -> C LOC_Os11g13820-LOC_Os11g13830 intergenic_region ; MODIFIER silent_mutation Average:65.023; most accessible tissue: Callus, score: 95.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107619278 NA 1.04E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1107619278 NA 4.15E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107619278 NA 4.82E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107619278 NA 1.88E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107619278 NA 8.51E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107619278 NA 2.83E-06 mr1372 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107619278 NA 3.89E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251