| Variant ID: vg1107588911 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7588911 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTCTTTTTCTTCTCCCCTATCGTGATGCGCACTATTGTTGTTATGGTTACCATTGAGGTCGGAGATGTCGAGCTTGCAGGGACTTTGGAAGGTAGGAGCT[G/A,T]
ACCCGACGAAGAGCGAAGGCGCTATATCCGGGCTCTTTCTTGCTAGATATATCGGTTATCCAACTGTCGGATGGAAAAAGAAAATGGAGAGAGAGAGAGT
ACTCTCTCTCTCTCCATTTTCTTTTTCCATCCGACAGTTGGATAACCGATATATCTAGCAAGAAAGAGCCCGGATATAGCGCCTTCGCTCTTCGTCGGGT[C/T,A]
AGCTCCTACCTTCCAAAGTCCCTGCAAGCTCGACATCTCCGACCTCAATGGTAACCATAACAACAATAGTGCGCATCACGATAGGGGAGAAGAAAAAGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 39.90% | 0.32% | 0.00% | T: 0.04% |
| All Indica | 2759 | 95.20% | 4.50% | 0.25% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 7.90% | 91.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.90% | 2.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 10.40% | 0.25% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 3.40% | 96.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 10.10% | 89.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 46.70% | 4.44% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107588911 | G -> T | LOC_Os11g13800.1 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> T | LOC_Os11g13800.2 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> T | LOC_Os11g13800.3 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> T | LOC_Os11g13800-LOC_Os11g13810 | intergenic_region ; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> A | LOC_Os11g13800.1 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> A | LOC_Os11g13800.2 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> A | LOC_Os11g13800.3 | upstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1107588911 | G -> A | LOC_Os11g13800-LOC_Os11g13810 | intergenic_region ; MODIFIER | silent_mutation | Average:65.888; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107588911 | 6.60E-07 | 2.29E-07 | mr1177 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 3.89E-08 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 1.08E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | 4.83E-06 | 4.83E-06 | mr1260 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 8.34E-06 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 2.18E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 2.22E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 3.11E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 3.07E-14 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107588911 | NA | 6.60E-22 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |