\
| Variant ID: vg1107200695 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7200695 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 259. )
ATACATAACCATTTAGGGAGTTCTCTCTCCATCGGTCAATGTTGAATGACCTTGCATTGTGATATATATTACTCGATCAACTACACATCAAATCTAACTA[T/A]
TCGAGTGAGGGATGAAGAATGATTGGTTCCATTATAATATCCTGTAGTGAACTCAGCTAGCCATTTCCATTCTGTGAACTTGCCCTAATATAACCTACAT
ATGTAGGTTATATTAGGGCAAGTTCACAGAATGGAAATGGCTAGCTGAGTTCACTACAGGATATTATAATGGAACCAATCATTCTTCATCCCTCACTCGA[A/T]
TAGTTAGATTTGATGTGTAGTTGATCGAGTAATATATATCACAATGCAAGGTCATTCAACATTGACCGATGGAGAGAGAACTCCCTAAATGGTTATGTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.40% | 82.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107200695 | T -> A | LOC_Os11g12740.1 | upstream_gene_variant ; 2143.0bp to feature; MODIFIER | silent_mutation | Average:50.317; most accessible tissue: Callus, score: 86.889 | N | N | N | N |
| vg1107200695 | T -> A | LOC_Os11g12740-LOC_Os11g12760 | intergenic_region ; MODIFIER | silent_mutation | Average:50.317; most accessible tissue: Callus, score: 86.889 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107200695 | 3.06E-07 | NA | mr1134 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107200695 | NA | 3.46E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107200695 | 4.42E-06 | NA | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107200695 | NA | 7.92E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107200695 | NA | 5.51E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107200695 | NA | 5.50E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |