\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107200695:

Variant ID: vg1107200695 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7200695
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATACATAACCATTTAGGGAGTTCTCTCTCCATCGGTCAATGTTGAATGACCTTGCATTGTGATATATATTACTCGATCAACTACACATCAAATCTAACTA[T/A]
TCGAGTGAGGGATGAAGAATGATTGGTTCCATTATAATATCCTGTAGTGAACTCAGCTAGCCATTTCCATTCTGTGAACTTGCCCTAATATAACCTACAT

Reverse complement sequence

ATGTAGGTTATATTAGGGCAAGTTCACAGAATGGAAATGGCTAGCTGAGTTCACTACAGGATATTATAATGGAACCAATCATTCTTCATCCCTCACTCGA[A/T]
TAGTTAGATTTGATGTGTAGTTGATCGAGTAATATATATCACAATGCAAGGTCATTCAACATTGACCGATGGAGAGAGAACTCCCTAAATGGTTATGTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.80% 0.04% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 16.40% 82.90% 0.74% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107200695 T -> A LOC_Os11g12740.1 upstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:50.317; most accessible tissue: Callus, score: 86.889 N N N N
vg1107200695 T -> A LOC_Os11g12740-LOC_Os11g12760 intergenic_region ; MODIFIER silent_mutation Average:50.317; most accessible tissue: Callus, score: 86.889 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107200695 3.06E-07 NA mr1134 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107200695 NA 3.46E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107200695 4.42E-06 NA mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107200695 NA 7.92E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107200695 NA 5.51E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107200695 NA 5.50E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251