\
| Variant ID: vg1107084984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7084984 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGAGACAGAAGAGAGCGAGACGATGGAGAAGAGAGCGAAACGAGAGAGGGAGAGAAGAGGGAGCGAGACAAATCGACGATGAGAGCGAGACGTCGAACCT[T/G]
ATTCGATGCTCGTCTTGTGTGGGGGCCACCGGTCGGCTCATCCGATGCCGGCTCGGCTCGATTCACATAGGTGTCGGTTTTTTAACCGACACCTATAATA
TATTATAGGTGTCGGTTAAAAAACCGACACCTATGTGAATCGAGCCGAGCCGGCATCGGATGAGCCGACCGGTGGCCCCCACACAAGACGAGCATCGAAT[A/C]
AGGTTCGACGTCTCGCTCTCATCGTCGATTTGTCTCGCTCCCTCTTCTCTCCCTCTCTCGTTTCGCTCTCTTCTCCATCGTCTCGCTCTCTTCTGTCTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 3.90% | 2.18% | 1.14% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 78.00% | 12.10% | 6.42% | 3.51% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 65.30% | 21.30% | 7.95% | 5.48% | NA |
| Tropical Japonica | 504 | 95.80% | 0.00% | 2.98% | 1.19% | NA |
| Japonica Intermediate | 241 | 80.90% | 8.30% | 8.71% | 2.07% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107084984 | T -> DEL | N | N | silent_mutation | Average:54.866; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1107084984 | T -> G | LOC_Os11g12610.1 | upstream_gene_variant ; 195.0bp to feature; MODIFIER | silent_mutation | Average:54.866; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1107084984 | T -> G | LOC_Os11g12610-LOC_Os11g12620 | intergenic_region ; MODIFIER | silent_mutation | Average:54.866; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107084984 | 3.23E-06 | 3.22E-06 | mr1030 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 5.10E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 6.98E-07 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | 8.08E-06 | 1.26E-06 | mr1380 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 2.19E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 4.90E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 1.26E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 7.09E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 6.06E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 2.17E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 5.55E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107084984 | NA | 6.43E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |