\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106628056:

Variant ID: vg1106628056 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6628056
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGAAAGGACCTAAACCTAAGAAAATCTTGTTTGGCTTTCATAAGGCTAGCCCAAAAATATGAGTCCCCCGCTTTTCAAAAAGCCTGAGATAAAGGTTG[C/T]
GATCCCAAATATTTATTACGTAGCATATCTTGCCATAATTTTGGAACAGAAAATAGTATTAATAAGGGTAGCTTAGTAATTGCTCAATCCCAGTTCCCCA

Reverse complement sequence

TGGGGAACTGGGATTGAGCAATTACTAAGCTACCCTTATTAATACTATTTTCTGTTCCAAAATTATGGCAAGATATGCTACGTAATAAATATTTGGGATC[G/A]
CAACCTTTATCTCAGGCTTTTTGAAAAGCGGGGGACTCATATTTTTGGGCTAGCCTTATGAAAGCCAAACAAGATTTTCTTAGGTTTAGGTCCTTTCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 11.40% 0.95% 20.55% NA
All Indica  2759 64.70% 12.40% 1.01% 21.86% NA
All Japonica  1512 79.80% 0.70% 0.60% 18.85% NA
Aus  269 13.00% 62.80% 2.23% 21.93% NA
Indica I  595 40.20% 8.20% 3.03% 48.57% NA
Indica II  465 88.60% 3.00% 0.00% 8.39% NA
Indica III  913 69.90% 16.80% 0.11% 13.25% NA
Indica Intermediate  786 63.20% 16.00% 1.15% 19.59% NA
Temperate Japonica  767 73.90% 0.30% 0.52% 25.29% NA
Tropical Japonica  504 90.10% 1.00% 0.60% 8.33% NA
Japonica Intermediate  241 77.20% 1.70% 0.83% 20.33% NA
VI/Aromatic  96 82.30% 6.20% 2.08% 9.38% NA
Intermediate  90 72.20% 11.10% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106628056 C -> T LOC_Os11g11950.1 downstream_gene_variant ; 3902.0bp to feature; MODIFIER silent_mutation Average:41.777; most accessible tissue: Callus, score: 71.362 N N N N
vg1106628056 C -> T LOC_Os11g11940.1 intron_variant ; MODIFIER silent_mutation Average:41.777; most accessible tissue: Callus, score: 71.362 N N N N
vg1106628056 C -> DEL N N silent_mutation Average:41.777; most accessible tissue: Callus, score: 71.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106628056 NA 5.75E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 5.84E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 7.60E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 7.02E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 2.10E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 2.19E-09 mr1286 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 2.00E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 7.16E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 2.07E-07 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 2.07E-07 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 1.15E-06 1.15E-06 mr1497 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 3.58E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 3.26E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 8.05E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 6.37E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 4.79E-08 mr1777 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 6.40E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 4.38E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106628056 NA 3.08E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251