\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105907484:

Variant ID: vg1105907484 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5907484
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GTATCCATAGTAGTAGTCGTCCCTCCGTTCCAATATACAGGAAATTTTGGGTGGCTATGACATATTTTAGTAGTACTATCTTCGTCCCATATTACTTGTC[T/C]
TTTTGAGTTTTTGTTTATCAATGTTTGATCATTCTTCTTATTCAAAAAATTTTAGAATTATTATTTATTTTGTTTGTCATTTGCTTTATTATCAAAAGTA

Reverse complement sequence

TACTTTTGATAATAAAGCAAATGACAAACAAAATAAATAATAATTCTAAAATTTTTTGAATAAGAAGAATGATCAAACATTGATAAACAAAAACTCAAAA[A/G]
GACAAGTAATATGGGACGAAGATAGTACTACTAAAATATGTCATAGCCACCCAAAATTTCCTGTATATTGGAACGGAGGGACGACTACTACTATGGATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 12.70% 0.72% 44.50% NA
All Indica  2759 11.60% 20.20% 1.05% 67.20% NA
All Japonica  1512 92.30% 0.50% 0.13% 7.01% NA
Aus  269 50.20% 7.10% 0.74% 42.01% NA
Indica I  595 3.70% 32.80% 1.01% 62.52% NA
Indica II  465 6.00% 3.90% 1.29% 88.82% NA
Indica III  913 17.60% 21.80% 1.10% 59.47% NA
Indica Intermediate  786 13.70% 18.40% 0.89% 66.92% NA
Temperate Japonica  767 96.90% 0.10% 0.13% 2.87% NA
Tropical Japonica  504 88.10% 1.40% 0.20% 10.32% NA
Japonica Intermediate  241 86.70% 0.00% 0.00% 13.28% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 50.00% 15.60% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105907484 T -> DEL N N silent_mutation Average:63.083; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1105907484 T -> C LOC_Os11g10750.1 upstream_gene_variant ; 4791.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1105907484 T -> C LOC_Os11g10760.1 downstream_gene_variant ; 466.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1105907484 T -> C LOC_Os11g10770.1 downstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1105907484 T -> C LOC_Os11g10750-LOC_Os11g10760 intergenic_region ; MODIFIER silent_mutation Average:63.083; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105907484 T C 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105907484 2.82E-06 7.09E-10 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 7.18E-11 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 7.56E-06 2.64E-09 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 1.74E-10 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 2.60E-06 5.43E-09 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 4.69E-06 1.24E-08 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 4.36E-08 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 2.82E-07 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 2.58E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 3.60E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 2.99E-08 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 3.19E-08 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 3.50E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 1.62E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 1.09E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 7.43E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 2.03E-06 mr1725 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 5.72E-07 mr1742 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 8.59E-06 6.08E-08 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 7.47E-09 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 5.06E-07 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 2.48E-08 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 3.89E-06 1.23E-09 mr1975 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 1.51E-08 mr1975 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 3.37E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 5.73E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 3.73E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 1.49E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105907484 NA 6.91E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251