Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105692960:

Variant ID: vg1105692960 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5692960
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCGTTCACGTTCACGTTAGGTTCACGTTCGTTCACGTTCACGTACGTTCGTTCGTTCACGTACGTTTCGTTCGTTCACGTTCTTTCACGTTCTCGTT[C/T]
ACGTTCGTTCGTTCGTTCACGTTCACGTACGTTTCGTCCGTTCACGATCGTTCTTCGTTCGTTCACGTGGCGGCAGCGGAGCGGCGGCGTGGCGCCGCGG

Reverse complement sequence

CCGCGGCGCCACGCCGCCGCTCCGCTGCCGCCACGTGAACGAACGAAGAACGATCGTGAACGGACGAAACGTACGTGAACGTGAACGAACGAACGAACGT[G/A]
AACGAGAACGTGAAAGAACGTGAACGAACGAAACGTACGTGAACGAACGAACGTACGTGAACGTGAACGAACGTGAACCTAACGTGAACGTGAACGAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	3.20%	11.57%	8.72%	NA
All Indica	2759	64.60%	4.90%	17.47%	13.01%	NA
All Japonica	1512	96.10%	0.10%	1.19%	2.65%	NA
Aus	269	80.70%	4.50%	14.50%	0.37%	NA
Indica I	595	49.20%	2.20%	47.06%	1.51%	NA
Indica II	465	58.90%	0.40%	10.11%	30.54%	NA
Indica III	913	77.50%	9.40%	4.82%	8.21%	NA
Indica Intermediate	786	64.60%	4.30%	14.12%	16.92%	NA
Temperate Japonica	767	98.60%	0.00%	0.26%	1.17%	NA
Tropical Japonica	504	93.50%	0.20%	2.58%	3.77%	NA
Japonica Intermediate	241	93.80%	0.00%	1.24%	4.98%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	76.70%	2.20%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105692960	C -> T	LOC_Os11g10440.1	upstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:31.234; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg1105692960	C -> T	LOC_Os11g10450.1	downstream_gene_variant ; 1351.0bp to feature; MODIFIER	silent_mutation	Average:31.234; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg1105692960	C -> T	LOC_Os11g10440-LOC_Os11g10450	intergenic_region ; MODIFIER	silent_mutation	Average:31.234; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg1105692960	C -> DEL	N	N	silent_mutation	Average:31.234; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105692960	NA	6.60E-13	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105692960	NA	3.65E-12	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105692960	NA	1.39E-12	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	5.57E-08	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	3.61E-17	mr1272	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	9.43E-10	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	8.00E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	3.23E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	1.98E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	3.83E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	5.01E-13	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	5.81E-07	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	7.61E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	4.59E-10	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	3.22E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105692960	NA	1.79E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251