Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104828509:

Variant ID: vg1104828509 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4828509
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAACATATATGTGGGATGTGAGATTAGTTGTCCATCATACCAAGTTAAAAAAAAATATGTGGGATGTGAGACTCAAACTCAAGATCTCTCACTTCA[G/A]
CCCTCACTCGCGTTATCATCCCATCTACTACACACATATGATGACTTGGATACTTTTGAAACTAACCATGGAAGCATCTTTTATCTGGGTTGGTAACACC

Reverse complement sequence

GGTGTTACCAACCCAGATAAAAGATGCTTCCATGGTTAGTTTCAAAAGTATCCAAGTCATCATATGTGTGTAGTAGATGGGATGATAACGCGAGTGAGGG[C/T]
TGAAGTGAGAGATCTTGAGTTTGAGTCTCACATCCCACATATTTTTTTTTAACTTGGTATGATGGACAACTAATCTCACATCCCACATATATGTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.30%	29.60%	0.06%	0.00%	NA
All Indica	2759	51.10%	48.90%	0.07%	0.00%	NA
All Japonica	1512	98.40%	1.50%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	64.00%	36.00%	0.00%	0.00%	NA
Indica II	465	13.50%	86.00%	0.43%	0.00%	NA
Indica III	913	63.50%	36.50%	0.00%	0.00%	NA
Indica Intermediate	786	49.00%	51.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	2.70%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104828509	G -> A	LOC_Os11g09100.1	downstream_gene_variant ; 1688.0bp to feature; MODIFIER	silent_mutation	Average:44.07; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1104828509	G -> A	LOC_Os11g09080-LOC_Os11g09100	intergenic_region ; MODIFIER	silent_mutation	Average:44.07; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104828509	NA	3.51E-23	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104828509	NA	5.95E-18	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104828509	NA	4.50E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	2.76E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	7.94E-09	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.60E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	4.30E-13	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.68E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.62E-19	mr1183	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	4.01E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	5.98E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	4.70E-20	mr1503	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.86E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	9.53E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.00E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.43E-09	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	4.83E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.88E-20	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	7.43E-08	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.03E-29	mr1183_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.06E-10	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	2.36E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.42E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	2.32E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	6.91E-06	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.60E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.77E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	6.82E-06	mr1320_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	7.46E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	8.01E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.94E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	5.55E-07	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.07E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	2.77E-11	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.60E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.39E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	3.38E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	1.17E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	6.99E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104828509	NA	5.20E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251