Variant ID: vg1104747649 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 4747649 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCTGACGCCGCCCTGCCACCTCCCTACATCCTCGACGCTTCCCTCGCTGCCTGGACAGCGGGGACGGAGGAACAGGTAAGATTATTAGTGCAGTACCAT[G/C]
TTTGTGCATTTTTCCCGTTCCCTGTTGTGCTAGCGTACATTAGTTCATCGTTTTTGTGTGAACCATATATCAATCTCATTATATGTTTAATTGTTAGAAC
GTTCTAACAATTAAACATATAATGAGATTGATATATGGTTCACACAAAAACGATGAACTAATGTACGCTAGCACAACAGGGAACGGGAAAAATGCACAAA[C/G]
ATGGTACTGCACTAATAATCTTACCTGTTCCTCCGTCCCCGCTGTCCAGGCAGCGAGGGAAGCGTCGAGGATGTAGGGAGGTGGCAGGGCGGCGTCAGAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.70% | 2.10% | 1.02% | 12.10% | NA |
All Indica | 2759 | 75.00% | 3.60% | 1.63% | 19.83% | NA |
All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
Indica I | 595 | 73.40% | 2.90% | 1.51% | 22.18% | NA |
Indica II | 465 | 90.30% | 0.60% | 0.65% | 8.39% | NA |
Indica III | 913 | 73.80% | 0.40% | 1.86% | 23.88% | NA |
Indica Intermediate | 786 | 68.40% | 9.40% | 2.04% | 20.10% | NA |
Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 83.30% | 2.10% | 2.08% | 12.50% | NA |
Intermediate | 90 | 92.20% | 1.10% | 1.11% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1104747649 | G -> DEL | N | N | silent_mutation | Average:22.158; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
vg1104747649 | G -> C | LOC_Os11g08950-LOC_Os11g08970 | intergenic_region ; MODIFIER | silent_mutation | Average:22.158; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1104747649 | NA | 5.67E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 2.50E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 8.72E-07 | mr1730 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | 4.71E-06 | 4.70E-06 | mr1777 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 4.12E-06 | mr1981 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 6.88E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 7.85E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 1.25E-07 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1104747649 | NA | 3.05E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |