\
| Variant ID: vg1104601543 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4601543 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.23, others allele: 0.00, population size: 241. )
ACAGATGAGGCAGAAAAGTTGCAACAGAAAGGGCTACGTTCAGCAGTCTTGACCACACTTTGGGAGATTTGGATGGAAAGGAACAATCGCATCTTCAGAG[A/G]
GAAAGAATCTACAGCATCAGCACTTGCTAGCAAGATCATAGATGAGCTTCATTTGTGGAAAATGGCAGGTGCCAAGGGAGTGAAGTGTATTATGTTAATA
TATTAACATAATACACTTCACTCCCTTGGCACCTGCCATTTTCCACAAATGAAGCTCATCTATGATCTTGCTAGCAAGTGCTGATGCTGTAGATTCTTTC[T/C]
CTCTGAAGATGCGATTGTTCCTTTCCATCCAAATCTCCCAAAGTGTGGTCAAGACTGCTGAACGTAGCCCTTTCTGTTGCAACTTTTCTGCCTCATCTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 40.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 52.30% | 47.40% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 74.90% | 25.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.80% | 81.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.50% | 44.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 57.80% | 41.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 59.30% | 40.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104601543 | A -> G | LOC_Os11g08640.1 | downstream_gene_variant ; 499.0bp to feature; MODIFIER | silent_mutation | Average:53.175; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg1104601543 | A -> G | LOC_Os11g08640-LOC_Os11g08650 | intergenic_region ; MODIFIER | silent_mutation | Average:53.175; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104601543 | NA | 4.04E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 2.57E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 2.88E-10 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 6.91E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 3.83E-08 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 1.22E-06 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 2.19E-07 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 2.26E-06 | mr1788_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 3.37E-10 | mr1887_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104601543 | NA | 3.28E-07 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |