Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104596397:

Variant ID: vg1104596397 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4596397
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GAATTTTTCAAATTTCAACTATTTCCTAATTGTATTTTTATGTGGACTCTATACTTTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTT[C/T]
CTAATTGTATTTCTATATGGATTCTTATCCCCTCTTCTAATATTCCTTATTTTTAATTCCGAATTTTAACTATTAAATTGTGTTTCTATATGGACTCTGG

Reverse complement sequence

CCAGAGTCCATATAGAAACACAATTTAATAGTTAAAATTCGGAATTAAAAATAAGGAATATTAGAAGAGGGGATAAGAATCCATATAGAAATACAATTAG[G/A]
AAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAAAGTATAGAGTCCACATAAAAATACAATTAGGAAATAGTTGAAATTTGAAAAATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	0.70%	20.38%	0.19%	NA
All Indica	2759	87.00%	0.40%	12.47%	0.14%	NA
All Japonica	1512	71.60%	0.90%	27.18%	0.33%	NA
Aus	269	34.20%	2.60%	63.20%	0.00%	NA
Indica I	595	59.80%	1.00%	38.49%	0.67%	NA
Indica II	465	96.80%	0.20%	3.01%	0.00%	NA
Indica III	913	94.90%	0.10%	5.04%	0.00%	NA
Indica Intermediate	786	92.70%	0.30%	7.00%	0.00%	NA
Temperate Japonica	767	54.20%	1.40%	43.68%	0.65%	NA
Tropical Japonica	504	95.00%	0.00%	4.96%	0.00%	NA
Japonica Intermediate	241	78.00%	0.80%	21.16%	0.00%	NA
VI/Aromatic	96	71.90%	1.00%	27.08%	0.00%	NA
Intermediate	90	86.70%	0.00%	13.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104596397	C -> T	LOC_Os11g08640.1	upstream_gene_variant ; 1113.0bp to feature; MODIFIER	silent_mutation	Average:15.525; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1104596397	C -> T	LOC_Os11g08630-LOC_Os11g08640	intergenic_region ; MODIFIER	silent_mutation	Average:15.525; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1104596397	C -> DEL	N	N	silent_mutation	Average:15.525; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104596397	NA	1.27E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	NA	1.20E-07	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	NA	4.15E-11	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	1.19E-07	1.19E-07	mr1337	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	3.43E-06	3.44E-06	mr1381	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	9.27E-07	1.17E-07	mr1484	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	7.94E-07	7.94E-07	mr1487	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	8.02E-07	NA	mr1500	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	NA	9.91E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	3.78E-06	NA	mr1549	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	3.16E-06	3.16E-06	mr1572	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	1.19E-07	5.71E-10	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	7.28E-06	NA	mr1923	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	6.58E-07	3.95E-06	mr1923	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	6.00E-07	2.59E-09	mr1933	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	8.33E-06	8.33E-06	mr1954	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	NA	6.81E-06	mr1397_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104596397	NA	2.08E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251