\
| Variant ID: vg1104585220 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4585220 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACAATCAAGCCGCTGGAAGTTTCATAGAGTGGTAGATATCCTATTCAATCTACATCAACATCGATATTTAACCTAATCAGCTGTATTCTACCAACAGATG[T/C]
TAGCCGATTGTAGGTTAGATAACGATATTGCTAGAGATTATATAAGATATATGATAACTCGACGGATTACATAAACAAGATTAGAGTGTCATAAAGATGT
ACATCTTTATGACACTCTAATCTTGTTTATGTAATCCGTCGAGTTATCATATATCTTATATAATCTCTAGCAATATCGTTATCTAACCTACAATCGGCTA[A/G]
CATCTGTTGGTAGAATACAGCTGATTAGGTTAAATATCGATGTTGATGTAGATTGAATAGGATATCTACCACTCTATGAAACTTCCAGCGGCTTGATTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 14.60% | 7.24% | 39.15% | NA |
| All Indica | 2759 | 22.80% | 24.60% | 10.08% | 42.52% | NA |
| All Japonica | 1512 | 67.70% | 0.10% | 1.19% | 31.02% | NA |
| Aus | 269 | 29.00% | 1.50% | 9.29% | 60.22% | NA |
| Indica I | 595 | 12.90% | 1.50% | 4.87% | 80.67% | NA |
| Indica II | 465 | 28.40% | 26.90% | 10.11% | 34.62% | NA |
| Indica III | 913 | 21.60% | 43.80% | 12.81% | 21.80% | NA |
| Indica Intermediate | 786 | 28.50% | 18.30% | 10.81% | 42.37% | NA |
| Temperate Japonica | 767 | 54.50% | 0.00% | 1.04% | 44.46% | NA |
| Tropical Japonica | 504 | 81.90% | 0.20% | 1.39% | 16.47% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 1.24% | 18.67% | NA |
| VI/Aromatic | 96 | 69.80% | 1.00% | 10.42% | 18.75% | NA |
| Intermediate | 90 | 52.20% | 4.40% | 12.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104585220 | T -> DEL | N | N | silent_mutation | Average:8.608; most accessible tissue: Callus, score: 25.981 | N | N | N | N |
| vg1104585220 | T -> C | LOC_Os11g08610.1 | upstream_gene_variant ; 1488.0bp to feature; MODIFIER | silent_mutation | Average:8.608; most accessible tissue: Callus, score: 25.981 | N | N | N | N |
| vg1104585220 | T -> C | LOC_Os11g08620.1 | upstream_gene_variant ; 1262.0bp to feature; MODIFIER | silent_mutation | Average:8.608; most accessible tissue: Callus, score: 25.981 | N | N | N | N |
| vg1104585220 | T -> C | LOC_Os11g08630.1 | downstream_gene_variant ; 4353.0bp to feature; MODIFIER | silent_mutation | Average:8.608; most accessible tissue: Callus, score: 25.981 | N | N | N | N |
| vg1104585220 | T -> C | LOC_Os11g08610-LOC_Os11g08620 | intergenic_region ; MODIFIER | silent_mutation | Average:8.608; most accessible tissue: Callus, score: 25.981 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104585220 | NA | 1.44E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | 6.81E-07 | 1.15E-06 | mr1337 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | 5.90E-06 | 5.90E-06 | mr1337 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | NA | 2.30E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | 4.31E-07 | NA | mr1524 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | 5.25E-06 | 5.25E-06 | mr1524 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | NA | 3.97E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | NA | 2.63E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104585220 | NA | 6.50E-06 | mr1826_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |