\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104585220:

Variant ID: vg1104585220 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4585220
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATCAAGCCGCTGGAAGTTTCATAGAGTGGTAGATATCCTATTCAATCTACATCAACATCGATATTTAACCTAATCAGCTGTATTCTACCAACAGATG[T/C]
TAGCCGATTGTAGGTTAGATAACGATATTGCTAGAGATTATATAAGATATATGATAACTCGACGGATTACATAAACAAGATTAGAGTGTCATAAAGATGT

Reverse complement sequence

ACATCTTTATGACACTCTAATCTTGTTTATGTAATCCGTCGAGTTATCATATATCTTATATAATCTCTAGCAATATCGTTATCTAACCTACAATCGGCTA[A/G]
CATCTGTTGGTAGAATACAGCTGATTAGGTTAAATATCGATGTTGATGTAGATTGAATAGGATATCTACCACTCTATGAAACTTCCAGCGGCTTGATTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 14.60% 7.24% 39.15% NA
All Indica  2759 22.80% 24.60% 10.08% 42.52% NA
All Japonica  1512 67.70% 0.10% 1.19% 31.02% NA
Aus  269 29.00% 1.50% 9.29% 60.22% NA
Indica I  595 12.90% 1.50% 4.87% 80.67% NA
Indica II  465 28.40% 26.90% 10.11% 34.62% NA
Indica III  913 21.60% 43.80% 12.81% 21.80% NA
Indica Intermediate  786 28.50% 18.30% 10.81% 42.37% NA
Temperate Japonica  767 54.50% 0.00% 1.04% 44.46% NA
Tropical Japonica  504 81.90% 0.20% 1.39% 16.47% NA
Japonica Intermediate  241 80.10% 0.00% 1.24% 18.67% NA
VI/Aromatic  96 69.80% 1.00% 10.42% 18.75% NA
Intermediate  90 52.20% 4.40% 12.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104585220 T -> DEL N N silent_mutation Average:8.608; most accessible tissue: Callus, score: 25.981 N N N N
vg1104585220 T -> C LOC_Os11g08610.1 upstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:8.608; most accessible tissue: Callus, score: 25.981 N N N N
vg1104585220 T -> C LOC_Os11g08620.1 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:8.608; most accessible tissue: Callus, score: 25.981 N N N N
vg1104585220 T -> C LOC_Os11g08630.1 downstream_gene_variant ; 4353.0bp to feature; MODIFIER silent_mutation Average:8.608; most accessible tissue: Callus, score: 25.981 N N N N
vg1104585220 T -> C LOC_Os11g08610-LOC_Os11g08620 intergenic_region ; MODIFIER silent_mutation Average:8.608; most accessible tissue: Callus, score: 25.981 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104585220 NA 1.44E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 6.81E-07 1.15E-06 mr1337 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 5.90E-06 5.90E-06 mr1337 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 NA 2.30E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 4.31E-07 NA mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 5.25E-06 5.25E-06 mr1524 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 NA 3.97E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 NA 2.63E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220 NA 6.50E-06 mr1826_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251