Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104585220:

Variant ID: vg1104585220 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4585220
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAATCAAGCCGCTGGAAGTTTCATAGAGTGGTAGATATCCTATTCAATCTACATCAACATCGATATTTAACCTAATCAGCTGTATTCTACCAACAGATG[T/C]
TAGCCGATTGTAGGTTAGATAACGATATTGCTAGAGATTATATAAGATATATGATAACTCGACGGATTACATAAACAAGATTAGAGTGTCATAAAGATGT

Reverse complement sequence

ACATCTTTATGACACTCTAATCTTGTTTATGTAATCCGTCGAGTTATCATATATCTTATATAATCTCTAGCAATATCGTTATCTAACCTACAATCGGCTA[A/G]
CATCTGTTGGTAGAATACAGCTGATTAGGTTAAATATCGATGTTGATGTAGATTGAATAGGATATCTACCACTCTATGAAACTTCCAGCGGCTTGATTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	14.60%	7.24%	39.15%	NA
All Indica	2759	22.80%	24.60%	10.08%	42.52%	NA
All Japonica	1512	67.70%	0.10%	1.19%	31.02%	NA
Aus	269	29.00%	1.50%	9.29%	60.22%	NA
Indica I	595	12.90%	1.50%	4.87%	80.67%	NA
Indica II	465	28.40%	26.90%	10.11%	34.62%	NA
Indica III	913	21.60%	43.80%	12.81%	21.80%	NA
Indica Intermediate	786	28.50%	18.30%	10.81%	42.37%	NA
Temperate Japonica	767	54.50%	0.00%	1.04%	44.46%	NA
Tropical Japonica	504	81.90%	0.20%	1.39%	16.47%	NA
Japonica Intermediate	241	80.10%	0.00%	1.24%	18.67%	NA
VI/Aromatic	96	69.80%	1.00%	10.42%	18.75%	NA
Intermediate	90	52.20%	4.40%	12.22%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104585220	T -> DEL	N	N	silent_mutation	Average:8.608; most accessible tissue: Callus, score: 25.981	N	N	N	N
vg1104585220	T -> C	LOC_Os11g08610.1	upstream_gene_variant ; 1488.0bp to feature; MODIFIER	silent_mutation	Average:8.608; most accessible tissue: Callus, score: 25.981	N	N	N	N
vg1104585220	T -> C	LOC_Os11g08620.1	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:8.608; most accessible tissue: Callus, score: 25.981	N	N	N	N
vg1104585220	T -> C	LOC_Os11g08630.1	downstream_gene_variant ; 4353.0bp to feature; MODIFIER	silent_mutation	Average:8.608; most accessible tissue: Callus, score: 25.981	N	N	N	N
vg1104585220	T -> C	LOC_Os11g08610-LOC_Os11g08620	intergenic_region ; MODIFIER	silent_mutation	Average:8.608; most accessible tissue: Callus, score: 25.981	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104585220	NA	1.44E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	6.81E-07	1.15E-06	mr1337	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	5.90E-06	5.90E-06	mr1337	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	NA	2.30E-07	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	4.31E-07	NA	mr1524	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	5.25E-06	5.25E-06	mr1524	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	NA	3.97E-06	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	NA	2.63E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104585220	NA	6.50E-06	mr1826_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251