Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104513762:

Variant ID: vg1104513762 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4513762
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTGGATTTGTAGTTTATGCACAAGCGCCTTTGAAGACACTAATCATTTGTTTAGTGAATGCTCCTTCTTCAAGGAAGTTTGGTCTCTAGTTACTTCCT[G/A]
GCAACATTTACCTACAAACAATGTTGGCCTCTCTATCGGAACCTCTGATTGGTGGGCCCAAATTGATTGTGTGCGATCGAAGGAGCAAAAGAAGGCGATG

Reverse complement sequence

CATCGCCTTCTTTTGCTCCTTCGATCGCACACAATCAATTTGGGCCCACCAATCAGAGGTTCCGATAGAGAGGCCAACATTGTTTGTAGGTAAATGTTGC[C/T]
AGGAAGTAACTAGAGACCAAACTTCCTTGAAGAAGGAGCATTCACTAAACAAATGATTAGTGTCTTCAAAGGCGCTTGTGCATAAACTACAAATCCAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	1.70%	8.87%	40.14%	NA
All Indica	2759	41.90%	2.00%	9.17%	46.86%	NA
All Japonica	1512	67.90%	0.10%	1.06%	30.95%	NA
Aus	269	9.70%	7.40%	53.90%	29.00%	NA
Indica I	595	27.10%	3.20%	14.79%	54.96%	NA
Indica II	465	31.00%	0.40%	2.80%	65.81%	NA
Indica III	913	60.40%	2.60%	7.34%	29.68%	NA
Indica Intermediate	786	38.30%	1.40%	10.81%	49.49%	NA
Temperate Japonica	767	55.80%	0.00%	1.69%	42.50%	NA
Tropical Japonica	504	81.50%	0.20%	0.40%	17.86%	NA
Japonica Intermediate	241	78.00%	0.00%	0.41%	21.58%	NA
VI/Aromatic	96	74.00%	0.00%	1.04%	25.00%	NA
Intermediate	90	56.70%	1.10%	4.44%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104513762	G -> A	LOC_Os11g08536.1	downstream_gene_variant ; 3536.0bp to feature; MODIFIER	silent_mutation	Average:10.913; most accessible tissue: Callus, score: 28.697	N	N	N	N
vg1104513762	G -> A	LOC_Os11g08542.1	downstream_gene_variant ; 10.0bp to feature; MODIFIER	silent_mutation	Average:10.913; most accessible tissue: Callus, score: 28.697	N	N	N	N
vg1104513762	G -> A	LOC_Os11g08550.1	downstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:10.913; most accessible tissue: Callus, score: 28.697	N	N	N	N
vg1104513762	G -> A	LOC_Os11g08542-LOC_Os11g08550	intergenic_region ; MODIFIER	silent_mutation	Average:10.913; most accessible tissue: Callus, score: 28.697	N	N	N	N
vg1104513762	G -> DEL	N	N	silent_mutation	Average:10.913; most accessible tissue: Callus, score: 28.697	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104513762	9.07E-06	1.88E-14	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762	2.38E-08	5.68E-11	mr1874	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762	NA	1.20E-17	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762	NA	1.37E-08	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251