\
| Variant ID: vg1104513762 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4513762 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTGGATTTGTAGTTTATGCACAAGCGCCTTTGAAGACACTAATCATTTGTTTAGTGAATGCTCCTTCTTCAAGGAAGTTTGGTCTCTAGTTACTTCCT[G/A]
GCAACATTTACCTACAAACAATGTTGGCCTCTCTATCGGAACCTCTGATTGGTGGGCCCAAATTGATTGTGTGCGATCGAAGGAGCAAAAGAAGGCGATG
CATCGCCTTCTTTTGCTCCTTCGATCGCACACAATCAATTTGGGCCCACCAATCAGAGGTTCCGATAGAGAGGCCAACATTGTTTGTAGGTAAATGTTGC[C/T]
AGGAAGTAACTAGAGACCAAACTTCCTTGAAGAAGGAGCATTCACTAAACAAATGATTAGTGTCTTCAAAGGCGCTTGTGCATAAACTACAAATCCAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 1.70% | 8.87% | 40.14% | NA |
| All Indica | 2759 | 41.90% | 2.00% | 9.17% | 46.86% | NA |
| All Japonica | 1512 | 67.90% | 0.10% | 1.06% | 30.95% | NA |
| Aus | 269 | 9.70% | 7.40% | 53.90% | 29.00% | NA |
| Indica I | 595 | 27.10% | 3.20% | 14.79% | 54.96% | NA |
| Indica II | 465 | 31.00% | 0.40% | 2.80% | 65.81% | NA |
| Indica III | 913 | 60.40% | 2.60% | 7.34% | 29.68% | NA |
| Indica Intermediate | 786 | 38.30% | 1.40% | 10.81% | 49.49% | NA |
| Temperate Japonica | 767 | 55.80% | 0.00% | 1.69% | 42.50% | NA |
| Tropical Japonica | 504 | 81.50% | 0.20% | 0.40% | 17.86% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.00% | 0.41% | 21.58% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 1.04% | 25.00% | NA |
| Intermediate | 90 | 56.70% | 1.10% | 4.44% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104513762 | G -> A | LOC_Os11g08536.1 | downstream_gene_variant ; 3536.0bp to feature; MODIFIER | silent_mutation | Average:10.913; most accessible tissue: Callus, score: 28.697 | N | N | N | N |
| vg1104513762 | G -> A | LOC_Os11g08542.1 | downstream_gene_variant ; 10.0bp to feature; MODIFIER | silent_mutation | Average:10.913; most accessible tissue: Callus, score: 28.697 | N | N | N | N |
| vg1104513762 | G -> A | LOC_Os11g08550.1 | downstream_gene_variant ; 336.0bp to feature; MODIFIER | silent_mutation | Average:10.913; most accessible tissue: Callus, score: 28.697 | N | N | N | N |
| vg1104513762 | G -> A | LOC_Os11g08542-LOC_Os11g08550 | intergenic_region ; MODIFIER | silent_mutation | Average:10.913; most accessible tissue: Callus, score: 28.697 | N | N | N | N |
| vg1104513762 | G -> DEL | N | N | silent_mutation | Average:10.913; most accessible tissue: Callus, score: 28.697 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104513762 | 9.07E-06 | 1.88E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104513762 | 2.38E-08 | 5.68E-11 | mr1874 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104513762 | NA | 1.20E-17 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104513762 | NA | 1.37E-08 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |