\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104513762:

Variant ID: vg1104513762 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4513762
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTGGATTTGTAGTTTATGCACAAGCGCCTTTGAAGACACTAATCATTTGTTTAGTGAATGCTCCTTCTTCAAGGAAGTTTGGTCTCTAGTTACTTCCT[G/A]
GCAACATTTACCTACAAACAATGTTGGCCTCTCTATCGGAACCTCTGATTGGTGGGCCCAAATTGATTGTGTGCGATCGAAGGAGCAAAAGAAGGCGATG

Reverse complement sequence

CATCGCCTTCTTTTGCTCCTTCGATCGCACACAATCAATTTGGGCCCACCAATCAGAGGTTCCGATAGAGAGGCCAACATTGTTTGTAGGTAAATGTTGC[C/T]
AGGAAGTAACTAGAGACCAAACTTCCTTGAAGAAGGAGCATTCACTAAACAAATGATTAGTGTCTTCAAAGGCGCTTGTGCATAAACTACAAATCCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 1.70% 8.87% 40.14% NA
All Indica  2759 41.90% 2.00% 9.17% 46.86% NA
All Japonica  1512 67.90% 0.10% 1.06% 30.95% NA
Aus  269 9.70% 7.40% 53.90% 29.00% NA
Indica I  595 27.10% 3.20% 14.79% 54.96% NA
Indica II  465 31.00% 0.40% 2.80% 65.81% NA
Indica III  913 60.40% 2.60% 7.34% 29.68% NA
Indica Intermediate  786 38.30% 1.40% 10.81% 49.49% NA
Temperate Japonica  767 55.80% 0.00% 1.69% 42.50% NA
Tropical Japonica  504 81.50% 0.20% 0.40% 17.86% NA
Japonica Intermediate  241 78.00% 0.00% 0.41% 21.58% NA
VI/Aromatic  96 74.00% 0.00% 1.04% 25.00% NA
Intermediate  90 56.70% 1.10% 4.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104513762 G -> A LOC_Os11g08536.1 downstream_gene_variant ; 3536.0bp to feature; MODIFIER silent_mutation Average:10.913; most accessible tissue: Callus, score: 28.697 N N N N
vg1104513762 G -> A LOC_Os11g08542.1 downstream_gene_variant ; 10.0bp to feature; MODIFIER silent_mutation Average:10.913; most accessible tissue: Callus, score: 28.697 N N N N
vg1104513762 G -> A LOC_Os11g08550.1 downstream_gene_variant ; 336.0bp to feature; MODIFIER silent_mutation Average:10.913; most accessible tissue: Callus, score: 28.697 N N N N
vg1104513762 G -> A LOC_Os11g08542-LOC_Os11g08550 intergenic_region ; MODIFIER silent_mutation Average:10.913; most accessible tissue: Callus, score: 28.697 N N N N
vg1104513762 G -> DEL N N silent_mutation Average:10.913; most accessible tissue: Callus, score: 28.697 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104513762 9.07E-06 1.88E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762 2.38E-08 5.68E-11 mr1874 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762 NA 1.20E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104513762 NA 1.37E-08 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251