Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104467562:

Variant ID: vg1104467562 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4467562
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCATCGTGGATGACAGCATCCTCTTCGCTCTCTCGCAGGCGGTCCTCAATCTCCTTAACGCCTTCTGATTGCTTTCAATGTCCATCGACCCATGTTTCCG[A/C]
TTGAACTCTCGCAAGGAGTGCTTCACCAACTCGTTGTCGAAATCCGCTCCGCCAAGGTGAGTGTCACCGGCGGTGGCCTTCACCTCGAAGAGGCCCATAT

Reverse complement sequence

ATATGGGCCTCTTCGAGGTGAAGGCCACCGCCGGTGACACTCACCTTGGCGGAGCGGATTTCGACAACGAGTTGGTGAAGCACTCCTTGCGAGAGTTCAA[T/G]
CGGAAACATGGGTCGATGGACATTGAAAGCAATCAGAAGGCGTTAAGGAGATTGAGGACCGCCTGCGAGAGAGCGAAGAGGATGCTGTCATCCACGATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	0.30%	1.63%	15.85%	NA
All Indica	2759	89.10%	0.20%	1.01%	9.71%	NA
All Japonica	1512	76.50%	0.40%	1.98%	21.10%	NA
Aus	269	45.70%	0.00%	2.60%	51.67%	NA
Indica I	595	68.40%	0.80%	4.20%	26.55%	NA
Indica II	465	96.60%	0.00%	0.22%	3.23%	NA
Indica III	913	94.70%	0.00%	0.00%	5.26%	NA
Indica Intermediate	786	93.80%	0.00%	0.25%	5.98%	NA
Temperate Japonica	767	63.00%	0.70%	3.26%	33.12%	NA
Tropical Japonica	504	95.00%	0.00%	0.00%	4.96%	NA
Japonica Intermediate	241	80.90%	0.40%	2.07%	16.60%	NA
VI/Aromatic	96	71.90%	1.00%	10.42%	16.67%	NA
Intermediate	90	90.00%	0.00%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104467562	A -> DEL	LOC_Os11g08460.2	N	frameshift_variant	Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1104467562	A -> DEL	LOC_Os11g08460.1	N	frameshift_variant	Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1104467562	A -> C	LOC_Os11g08460.1	missense_variant ; p.Asn269Lys; MODERATE	nonsynonymous_codon	Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325	benign	-1.414	TOLERATED	1.00
vg1104467562	A -> C	LOC_Os11g08460.2	missense_variant ; p.Asn153Lys; MODERATE	nonsynonymous_codon	Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325	benign	-1.436	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104467562	NA	3.52E-06	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	NA	5.51E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	1.51E-06	1.51E-06	mr1286_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	2.09E-07	2.09E-07	mr1312_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	2.23E-06	1.27E-07	mr1397_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	3.25E-07	3.25E-07	mr1427_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	8.77E-06	8.77E-06	mr1663_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	1.06E-07	1.06E-07	mr1665_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	NA	3.04E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	2.13E-06	2.13E-06	mr1687_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	9.80E-07	9.79E-07	mr1738_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	NA	2.86E-06	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	1.93E-06	1.93E-06	mr1812_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	7.27E-06	7.27E-06	mr1816_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	4.24E-06	4.24E-06	mr1822_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	9.66E-07	9.65E-07	mr1832_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	5.03E-06	5.03E-06	mr1843_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562	1.66E-06	1.66E-06	mr1847_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251