\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104467562:

Variant ID: vg1104467562 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4467562
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATCGTGGATGACAGCATCCTCTTCGCTCTCTCGCAGGCGGTCCTCAATCTCCTTAACGCCTTCTGATTGCTTTCAATGTCCATCGACCCATGTTTCCG[A/C]
TTGAACTCTCGCAAGGAGTGCTTCACCAACTCGTTGTCGAAATCCGCTCCGCCAAGGTGAGTGTCACCGGCGGTGGCCTTCACCTCGAAGAGGCCCATAT

Reverse complement sequence

ATATGGGCCTCTTCGAGGTGAAGGCCACCGCCGGTGACACTCACCTTGGCGGAGCGGATTTCGACAACGAGTTGGTGAAGCACTCCTTGCGAGAGTTCAA[T/G]
CGGAAACATGGGTCGATGGACATTGAAAGCAATCAGAAGGCGTTAAGGAGATTGAGGACCGCCTGCGAGAGAGCGAAGAGGATGCTGTCATCCACGATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 0.30% 1.63% 15.85% NA
All Indica  2759 89.10% 0.20% 1.01% 9.71% NA
All Japonica  1512 76.50% 0.40% 1.98% 21.10% NA
Aus  269 45.70% 0.00% 2.60% 51.67% NA
Indica I  595 68.40% 0.80% 4.20% 26.55% NA
Indica II  465 96.60% 0.00% 0.22% 3.23% NA
Indica III  913 94.70% 0.00% 0.00% 5.26% NA
Indica Intermediate  786 93.80% 0.00% 0.25% 5.98% NA
Temperate Japonica  767 63.00% 0.70% 3.26% 33.12% NA
Tropical Japonica  504 95.00% 0.00% 0.00% 4.96% NA
Japonica Intermediate  241 80.90% 0.40% 2.07% 16.60% NA
VI/Aromatic  96 71.90% 1.00% 10.42% 16.67% NA
Intermediate  90 90.00% 0.00% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104467562 A -> DEL LOC_Os11g08460.2 N frameshift_variant Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1104467562 A -> DEL LOC_Os11g08460.1 N frameshift_variant Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1104467562 A -> C LOC_Os11g08460.1 missense_variant ; p.Asn269Lys; MODERATE nonsynonymous_codon Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325 benign -1.414 TOLERATED 1.00
vg1104467562 A -> C LOC_Os11g08460.2 missense_variant ; p.Asn153Lys; MODERATE nonsynonymous_codon Average:60.637; most accessible tissue: Zhenshan97 young leaf, score: 80.325 benign -1.436 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104467562 NA 3.52E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 NA 5.51E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 1.51E-06 1.51E-06 mr1286_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 2.09E-07 2.09E-07 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 2.23E-06 1.27E-07 mr1397_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 3.25E-07 3.25E-07 mr1427_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 8.77E-06 8.77E-06 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 1.06E-07 1.06E-07 mr1665_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 NA 3.04E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 2.13E-06 2.13E-06 mr1687_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 9.80E-07 9.79E-07 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 NA 2.86E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 1.93E-06 1.93E-06 mr1812_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 7.27E-06 7.27E-06 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 4.24E-06 4.24E-06 mr1822_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 9.66E-07 9.65E-07 mr1832_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 5.03E-06 5.03E-06 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104467562 1.66E-06 1.66E-06 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251