Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104411559:

Variant ID: vg1104411559 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4411559
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CACTGTGGCGACGATCTTCTCCACAATACTAAGATCAATTCGTGGCATTCTGTTCCATTTTATTGGATCCTTTTCATTTTAGGTTAATACTAGAAAAAAT[A/G]
CAGGTGCGTTGCAACGGGTAAAGACATTTTTTCCAGTGATATAACAACTGTTGAGAGCTGAGTAATAAATTGAAACACCAATATCGCTATACATTATAAT

Reverse complement sequence

ATTATAATGTATAGCGATATTGGTGTTTCAATTTATTACTCAGCTCTCAACAGTTGTTATATCACTGGAAAAAATGTCTTTACCCGTTGCAACGCACCTG[T/C]
ATTTTTTCTAGTATTAACCTAAAATGAAAAGGATCCAATAAAATGGAACAGAATGCCACGAATTGATCTTAGTATTGTGGAGAAGATCGTCGCCACAGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	39.10%	0.13%	0.00%	NA
All Indica	2759	42.20%	57.60%	0.14%	0.00%	NA
All Japonica	1512	90.70%	9.30%	0.07%	0.00%	NA
Aus	269	69.50%	30.10%	0.37%	0.00%	NA
Indica I	595	46.40%	53.60%	0.00%	0.00%	NA
Indica II	465	75.50%	24.50%	0.00%	0.00%	NA
Indica III	913	28.50%	71.40%	0.11%	0.00%	NA
Indica Intermediate	786	35.40%	64.20%	0.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	75.40%	24.40%	0.20%	0.00%	NA
Japonica Intermediate	241	94.60%	5.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104411559	A -> G	LOC_Os11g08350.1	upstream_gene_variant ; 2429.0bp to feature; MODIFIER	silent_mutation	Average:62.567; most accessible tissue: Callus, score: 86.489	N	N	N	N
vg1104411559	A -> G	LOC_Os11g08370.1	upstream_gene_variant ; 1681.0bp to feature; MODIFIER	silent_mutation	Average:62.567; most accessible tissue: Callus, score: 86.489	N	N	N	N
vg1104411559	A -> G	LOC_Os11g08360.1	downstream_gene_variant ; 1526.0bp to feature; MODIFIER	silent_mutation	Average:62.567; most accessible tissue: Callus, score: 86.489	N	N	N	N
vg1104411559	A -> G	LOC_Os11g08380.1	downstream_gene_variant ; 4351.0bp to feature; MODIFIER	silent_mutation	Average:62.567; most accessible tissue: Callus, score: 86.489	N	N	N	N
vg1104411559	A -> G	LOC_Os11g08360-LOC_Os11g08370	intergenic_region ; MODIFIER	silent_mutation	Average:62.567; most accessible tissue: Callus, score: 86.489	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104411559	NA	3.39E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	1.95E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	7.57E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	6.10E-06	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	4.42E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	4.99E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	3.70E-07	NA	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	2.33E-06	1.20E-09	mr1457	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	2.58E-06	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	2.20E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	1.15E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	9.98E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	7.40E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	9.81E-07	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	4.17E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104411559	NA	2.31E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251