\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104399623:

Variant ID: vg1104399623 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4399623
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATTAGTAATTCCCGTATCAAAGCGCGGGAAATCATACATTGGAAAAGACTATACAATTGTATATTGTAGAGTGATATACCTGACGCAAGCGGTATCG[C/T]
AAGTGTTAAAATATTGATTTAACAATTACTATCCAATAGACATTTCGATATAATCGATGACACACTTTGGTTGTGTTTAGTTCTTTGGTCAAAATTTTTT

Reverse complement sequence

AAAAAATTTTGACCAAAGAACTAAACACAACCAAAGTGTGTCATCGATTATATCGAAATGTCTATTGGATAGTAATTGTTAAATCAATATTTTAACACTT[G/A]
CGATACCGCTTGCGTCAGGTATATCACTCTACAATATACAATTGTATAGTCTTTTCCAATGTATGATTTCCCGCGCTTTGATACGGGAATTACTAATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 46.30% 0.17% 0.00% NA
All Indica  2759 31.20% 68.50% 0.25% 0.00% NA
All Japonica  1512 89.00% 10.90% 0.07% 0.00% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 78.00% 21.80% 0.17% 0.00% NA
Indica II  465 10.80% 89.00% 0.22% 0.00% NA
Indica III  913 17.60% 82.00% 0.33% 0.00% NA
Indica Intermediate  786 23.70% 76.10% 0.25% 0.00% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 73.40% 26.60% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104399623 C -> T LOC_Os11g08330.1 upstream_gene_variant ; 1815.0bp to feature; MODIFIER silent_mutation Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg1104399623 C -> T LOC_Os11g08340.1 upstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg1104399623 C -> T LOC_Os11g08330-LOC_Os11g08340 intergenic_region ; MODIFIER silent_mutation Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104399623 NA 3.83E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 2.25E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 4.42E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 8.47E-09 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 5.75E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 5.10E-06 mr1402 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 4.99E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 1.00E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 2.02E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 9.67E-06 9.67E-06 mr1562 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 2.20E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 6.16E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 1.38E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 2.32E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 4.17E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 4.12E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 7.30E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623 NA 2.44E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251