Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104399623:

Variant ID: vg1104399623 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4399623
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TTAATTAGTAATTCCCGTATCAAAGCGCGGGAAATCATACATTGGAAAAGACTATACAATTGTATATTGTAGAGTGATATACCTGACGCAAGCGGTATCG[C/T]
AAGTGTTAAAATATTGATTTAACAATTACTATCCAATAGACATTTCGATATAATCGATGACACACTTTGGTTGTGTTTAGTTCTTTGGTCAAAATTTTTT

Reverse complement sequence

AAAAAATTTTGACCAAAGAACTAAACACAACCAAAGTGTGTCATCGATTATATCGAAATGTCTATTGGATAGTAATTGTTAAATCAATATTTTAACACTT[G/A]
CGATACCGCTTGCGTCAGGTATATCACTCTACAATATACAATTGTATAGTCTTTTCCAATGTATGATTTCCCGCGCTTTGATACGGGAATTACTAATTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	46.30%	0.17%	0.00%	NA
All Indica	2759	31.20%	68.50%	0.25%	0.00%	NA
All Japonica	1512	89.00%	10.90%	0.07%	0.00%	NA
Aus	269	69.50%	30.50%	0.00%	0.00%	NA
Indica I	595	78.00%	21.80%	0.17%	0.00%	NA
Indica II	465	10.80%	89.00%	0.22%	0.00%	NA
Indica III	913	17.60%	82.00%	0.33%	0.00%	NA
Indica Intermediate	786	23.70%	76.10%	0.25%	0.00%	NA
Temperate Japonica	767	98.60%	1.30%	0.13%	0.00%	NA
Tropical Japonica	504	73.40%	26.60%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104399623	C -> T	LOC_Os11g08330.1	upstream_gene_variant ; 1815.0bp to feature; MODIFIER	silent_mutation	Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg1104399623	C -> T	LOC_Os11g08340.1	upstream_gene_variant ; 1869.0bp to feature; MODIFIER	silent_mutation	Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg1104399623	C -> T	LOC_Os11g08330-LOC_Os11g08340	intergenic_region ; MODIFIER	silent_mutation	Average:40.267; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104399623	NA	3.83E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	2.25E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	4.42E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	8.47E-09	mr1231	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	5.75E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	5.10E-06	mr1402	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	4.99E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	1.00E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	2.02E-07	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	9.67E-06	9.67E-06	mr1562	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	2.20E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	6.16E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	1.38E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	2.32E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	4.17E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	4.12E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	7.30E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104399623	NA	2.44E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251