Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104316746:

Variant ID: vg1104316746 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4316746
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, T: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TCTAGCCAATCTCTTCAATCGATGTCGTTTTTCTCGTACAGTGCACACAAATGCGGGGATTGGGAGCTCCGCGAGATGCCCAAAATCTGGCTCACGAGGG[T/A]
ACCGGCCGGGATTAGGCATGCCCTGTACATGTTTTCTAACTTAATTTTCAAAATTTAGCTTTAGGTAATATGTTTAATTAGGGCATTCCGGGAAATGCTC

Reverse complement sequence

GAGCATTTCCCGGAATGCCCTAATTAAACATATTACCTAAAGCTAAATTTTGAAAATTAAGTTAGAAAACATGTACAGGGCATGCCTAATCCCGGCCGGT[A/T]
CCCTCGTGAGCCAGATTTTGGGCATCTCGCGGAGCTCCCAATCCCCGCATTTGTGTGCACTGTACGAGAAAAACGACATCGATTGAAGAGATTGGCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	38.40%	0.11%	0.85%	NA
All Indica	2759	88.50%	10.40%	0.14%	0.98%	NA
All Japonica	1512	11.40%	87.80%	0.07%	0.66%	NA
Aus	269	42.40%	57.60%	0.00%	0.00%	NA
Indica I	595	79.30%	19.70%	0.17%	0.84%	NA
Indica II	465	94.20%	3.90%	0.65%	1.29%	NA
Indica III	913	91.60%	8.30%	0.00%	0.11%	NA
Indica Intermediate	786	88.40%	9.70%	0.00%	1.91%	NA
Temperate Japonica	767	1.20%	98.40%	0.00%	0.39%	NA
Tropical Japonica	504	29.00%	69.80%	0.20%	0.99%	NA
Japonica Intermediate	241	7.50%	91.70%	0.00%	0.83%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104316746	T -> A	LOC_Os11g08220.1	downstream_gene_variant ; 1130.0bp to feature; MODIFIER	silent_mutation	Average:43.821; most accessible tissue: Callus, score: 76.668	N	N	N	N
vg1104316746	T -> A	LOC_Os11g08225.1	downstream_gene_variant ; 2008.0bp to feature; MODIFIER	silent_mutation	Average:43.821; most accessible tissue: Callus, score: 76.668	N	N	N	N
vg1104316746	T -> A	LOC_Os11g08230.1	downstream_gene_variant ; 2450.0bp to feature; MODIFIER	silent_mutation	Average:43.821; most accessible tissue: Callus, score: 76.668	N	N	N	N
vg1104316746	T -> A	LOC_Os11g08220-LOC_Os11g08225	intergenic_region ; MODIFIER	silent_mutation	Average:43.821; most accessible tissue: Callus, score: 76.668	N	N	N	N
vg1104316746	T -> DEL	N	N	silent_mutation	Average:43.821; most accessible tissue: Callus, score: 76.668	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104316746	8.45E-06	8.45E-06	mr1048	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	9.62E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	2.84E-08	1.59E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	8.48E-06	mr1283	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	7.26E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	2.57E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	2.32E-06	1.03E-06	mr1574	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	6.41E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	4.05E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	9.48E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	7.64E-07	4.61E-08	mr1633	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	8.93E-18	8.37E-57	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	2.35E-10	2.68E-13	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	2.93E-07	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	8.09E-06	mr1838	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	5.06E-06	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	5.15E-09	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	8.05E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746	NA	3.48E-09	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251