\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104316746:

Variant ID: vg1104316746 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4316746
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, T: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGCCAATCTCTTCAATCGATGTCGTTTTTCTCGTACAGTGCACACAAATGCGGGGATTGGGAGCTCCGCGAGATGCCCAAAATCTGGCTCACGAGGG[T/A]
ACCGGCCGGGATTAGGCATGCCCTGTACATGTTTTCTAACTTAATTTTCAAAATTTAGCTTTAGGTAATATGTTTAATTAGGGCATTCCGGGAAATGCTC

Reverse complement sequence

GAGCATTTCCCGGAATGCCCTAATTAAACATATTACCTAAAGCTAAATTTTGAAAATTAAGTTAGAAAACATGTACAGGGCATGCCTAATCCCGGCCGGT[A/T]
CCCTCGTGAGCCAGATTTTGGGCATCTCGCGGAGCTCCCAATCCCCGCATTTGTGTGCACTGTACGAGAAAAACGACATCGATTGAAGAGATTGGCTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 38.40% 0.11% 0.85% NA
All Indica  2759 88.50% 10.40% 0.14% 0.98% NA
All Japonica  1512 11.40% 87.80% 0.07% 0.66% NA
Aus  269 42.40% 57.60% 0.00% 0.00% NA
Indica I  595 79.30% 19.70% 0.17% 0.84% NA
Indica II  465 94.20% 3.90% 0.65% 1.29% NA
Indica III  913 91.60% 8.30% 0.00% 0.11% NA
Indica Intermediate  786 88.40% 9.70% 0.00% 1.91% NA
Temperate Japonica  767 1.20% 98.40% 0.00% 0.39% NA
Tropical Japonica  504 29.00% 69.80% 0.20% 0.99% NA
Japonica Intermediate  241 7.50% 91.70% 0.00% 0.83% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104316746 T -> A LOC_Os11g08220.1 downstream_gene_variant ; 1130.0bp to feature; MODIFIER silent_mutation Average:43.821; most accessible tissue: Callus, score: 76.668 N N N N
vg1104316746 T -> A LOC_Os11g08225.1 downstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:43.821; most accessible tissue: Callus, score: 76.668 N N N N
vg1104316746 T -> A LOC_Os11g08230.1 downstream_gene_variant ; 2450.0bp to feature; MODIFIER silent_mutation Average:43.821; most accessible tissue: Callus, score: 76.668 N N N N
vg1104316746 T -> A LOC_Os11g08220-LOC_Os11g08225 intergenic_region ; MODIFIER silent_mutation Average:43.821; most accessible tissue: Callus, score: 76.668 N N N N
vg1104316746 T -> DEL N N silent_mutation Average:43.821; most accessible tissue: Callus, score: 76.668 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104316746 8.45E-06 8.45E-06 mr1048 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 9.62E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 2.84E-08 1.59E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 8.48E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 7.26E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 2.57E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 2.32E-06 1.03E-06 mr1574 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 6.41E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 4.05E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 9.48E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 7.64E-07 4.61E-08 mr1633 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 8.93E-18 8.37E-57 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 2.35E-10 2.68E-13 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 2.93E-07 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 8.09E-06 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 5.06E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 5.15E-09 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 8.05E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316746 NA 3.48E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251