\
| Variant ID: vg1104295774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4295774 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )
GAGCAATCTTCAATGCAACCATGTCGTTTTGGTTTCAGTGCATCTATTGATGAGTTCTTTTTTTGTCAACCTTTTCTAATCAACACAGGTACCACACGTG[C/T]
TGTACAAGCCAACCCCAAAGAAGCTGGTGACCTGTGCCGACTCACTCTGCACTGACCTGTACACTGATCTGGGCAAGCCCAAGAGATGTGGATCCCAGAA
TTCTGGGATCCACATCTCTTGGGCTTGCCCAGATCAGTGTACAGGTCAGTGCAGAGTGAGTCGGCACAGGTCACCAGCTTCTTTGGGGTTGGCTTGTACA[G/A]
CACGTGTGGTACCTGTGTTGATTAGAAAAGGTTGACAAAAAAAGAACTCATCAATAGATGCACTGAAACCAAAACGACATGGTTGCATTGAAGATTGCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 38.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104295774 | C -> T | LOC_Os11g08200.1 | synonymous_variant ; p.Leu80Leu; LOW | synonymous_codon | Average:38.232; most accessible tissue: Callus, score: 86.522 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104295774 | NA | 7.45E-06 | mr1127 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | 2.12E-08 | 1.24E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | 1.95E-06 | 1.68E-08 | mr1522 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 1.88E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 2.26E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 4.78E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 1.52E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 6.94E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | 3.03E-18 | 3.16E-58 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | 7.91E-10 | 1.01E-12 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | 2.48E-06 | 1.13E-08 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 2.92E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104295774 | NA | 9.76E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |