\
| Variant ID: vg1103575882 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3575882 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )
TTAATTAATTACGTGCTAATGGATCGCTCCGTTTTTCGCGTGGAGGAGACGTGGGTTCCCAACCCGAAGGAGCTAACAGAGTGTTAGCTTGCTTTTCATC[G/A]
CATGTGCCATTATGGAGCATAGTACTTCCAAGCTAGTGTAAGACTCTGCATCTAATTAGGTTTCAAAAATAAAAGACTCTGCATCTAAAACCTGCATTAA
TTAATGCAGGTTTTAGATGCAGAGTCTTTTATTTTTGAAACCTAATTAGATGCAGAGTCTTACACTAGCTTGGAAGTACTATGCTCCATAATGGCACATG[C/T]
GATGAAAAGCAAGCTAACACTCTGTTAGCTCCTTCGGGTTGGGAACCCACGTCTCCTCCACGCGAAAAACGGAGCGATCCATTAGCACGTAATTAATTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 47.80% | 0.08% | 2.62% | NA |
| All Indica | 2759 | 69.70% | 28.20% | 0.11% | 2.03% | NA |
| All Japonica | 1512 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.40% | 3.30% | 0.37% | 24.91% | NA |
| Indica I | 595 | 95.00% | 1.20% | 0.17% | 3.70% | NA |
| Indica II | 465 | 33.80% | 65.80% | 0.22% | 0.22% | NA |
| Indica III | 913 | 75.50% | 22.80% | 0.00% | 1.75% | NA |
| Indica Intermediate | 786 | 65.10% | 32.60% | 0.13% | 2.16% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 54.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103575882 | G -> A | LOC_Os11g07160-LOC_Os11g07170 | intergenic_region ; MODIFIER | silent_mutation | Average:45.503; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg1103575882 | G -> DEL | N | N | silent_mutation | Average:45.503; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103575882 | NA | 1.21E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 2.15E-06 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 3.93E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | 1.85E-06 | 4.76E-15 | mr1557 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | 3.74E-06 | 2.32E-12 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 3.62E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 2.59E-09 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 6.48E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 1.07E-07 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 9.71E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 1.20E-06 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 4.83E-10 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 2.46E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 2.63E-11 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 2.00E-09 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 7.28E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 1.14E-06 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 3.64E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 7.78E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103575882 | NA | 6.64E-07 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |