Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1103187142:

Variant ID: vg1103187142 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3187142
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAACAAGCATGCATTAAAGTATAACCATAAAATAAAGATTTTACAATTAAGCTTGAATCATCAATCAAAATTCATGATTTCATACGATTTATAATGCAA[T/C]
ATCTTAACAAGCACATAGGTTGAAGAATAAACACTAAACACATATACCTATTGCATTTATCACTCTTTCTCAAATAACCTTTAGCACAAAACAACAAAGA

Reverse complement sequence

TCTTTGTTGTTTTGTGCTAAAGGTTATTTGAGAAAGAGTGATAAATGCAATAGGTATATGTGTTTAGTGTTTATTCTTCAACCTATGTGCTTGTTAAGAT[A/G]
TTGCATTATAAATCGTATGAAATCATGAATTTTGATTGATGATTCAAGCTTAATTGTAAAATCTTTATTTTATGGTTATACTTTAATGCATGCTTGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.10%	0.10%	1.29%	52.45%	NA
All Indica	2759	18.80%	0.20%	1.96%	79.09%	NA
All Japonica	1512	95.40%	0.00%	0.07%	4.50%	NA
Aus	269	28.30%	0.40%	1.49%	69.89%	NA
Indica I	595	23.20%	0.00%	3.36%	73.45%	NA
Indica II	465	18.70%	0.40%	1.29%	79.57%	NA
Indica III	913	14.00%	0.10%	1.64%	84.23%	NA
Indica Intermediate	786	21.00%	0.30%	1.65%	77.10%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	89.70%	0.00%	0.20%	10.12%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	62.20%	0.00%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103187142	T -> DEL	N	N	silent_mutation	Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N
vg1103187142	T -> C	LOC_Os11g06590.1	upstream_gene_variant ; 2973.0bp to feature; MODIFIER	silent_mutation	Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N
vg1103187142	T -> C	LOC_Os11g06595.1	downstream_gene_variant ; 2030.0bp to feature; MODIFIER	silent_mutation	Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N
vg1103187142	T -> C	LOC_Os11g06600.1	downstream_gene_variant ; 722.0bp to feature; MODIFIER	silent_mutation	Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N
vg1103187142	T -> C	LOC_Os11g06595-LOC_Os11g06600	intergenic_region ; MODIFIER	silent_mutation	Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103187142	2.07E-06	NA	mr1893_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103187142	1.82E-07	5.34E-07	mr1893_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251