Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1102801424:

Variant ID: vg1102801424 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2801424
Reference Allele: G	Alternative Allele: C,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, C: 0.45, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ACTAGCTGGCACCGAAAGACTATAATGACTCCCGAAATATACCAAAATGCTCTCAGGATTGCTGACATGGCAGGGGCACAATTATAATCTTACATGGGCT[G/C,T]
AGTGGGGGCACAATTGTAATATCATATGTATAGCTATGAATTATATAAAATAGCCAAAAAGCCTATAGCAAAAGGGGATATATCAGAATATAGAAATCTT

Reverse complement sequence

AAGATTTCTATATTCTGATATATCCCCTTTTGCTATAGGCTTTTTGGCTATTTTATATAATTCATAGCTATACATATGATATTACAATTGTGCCCCCACT[C/G,A]
AGCCCATGTAAGATTATAATTGTGCCCCTGCCATGTCAGCAATCCTGAGAGCATTTTGGTATATTTCGGGAGTCATTATAGTCTTTCGGTGCCAGCTAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	25.10%	0.19%	0.19%	T: 0.19%
All Indica	2759	59.50%	39.90%	0.25%	0.33%	T: 0.04%
All Japonica	1512	97.00%	2.90%	0.13%	0.00%	NA
Aus	269	88.10%	8.90%	0.00%	0.00%	T: 2.97%
Indica I	595	95.30%	4.50%	0.17%	0.00%	NA
Indica II	465	25.80%	73.30%	0.00%	0.86%	NA
Indica III	913	56.60%	42.70%	0.22%	0.44%	NA
Indica Intermediate	786	55.60%	43.60%	0.51%	0.13%	T: 0.13%
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	91.90%	8.10%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102801424	G -> T	LOC_Os11g05940.1	intron_variant ; MODIFIER	silent_mutation	Average:52.842; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg1102801424	G -> DEL	N	N	silent_mutation	Average:52.842; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg1102801424	G -> C	LOC_Os11g05940.1	intron_variant ; MODIFIER	silent_mutation	Average:52.842; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102801424	NA	1.26E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	7.95E-07	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	9.96E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	6.88E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	6.02E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	2.07E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	8.19E-11	mr1383_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	1.90E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102801424	NA	3.19E-12	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251