\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102661323:

Variant ID: vg1102661323 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 2661323
Reference Allele: GAlternative Allele: A,GA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATCTCTAGCCGAAATTTCTTCTAGCATACTCCTCCCGTGAAAAAAAAAAGATAAACCCTGGATTTCCGTGTCCAACGTTTGACCGTCCGTCTTATTT[G/A,GA]
AAAAAATTAGAAAGACAAGTTACGCATAAAGTATTGATCATATTTTATCATCTAATAACAATGAAAATACTAATTATAAAAAAATTTCATATAAAACGGA

Reverse complement sequence

TCCGTTTTATATGAAATTTTTTTATAATTAGTATTTTCATTGTTATTAGATGATAAAATATGATCAATACTTTATGCGTAACTTGTCTTTCTAATTTTTT[C/T,TC]
AAATAAGACGGACGGTCAAACGTTGGACACGGAAATCCAGGGTTTATCTTTTTTTTTTCACGGGAGGAGTATGCTAGAAGAAATTTCGGCTAGAGATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 0.70% 31.57% 6.71% GA: 0.02%
All Indica  2759 39.50% 1.10% 49.87% 9.60% NA
All Japonica  1512 96.70% 0.00% 0.60% 2.71% NA
Aus  269 63.90% 0.70% 31.97% 2.97% GA: 0.37%
Indica I  595 70.40% 0.50% 27.39% 1.68% NA
Indica II  465 19.80% 1.50% 64.52% 14.19% NA
Indica III  913 25.60% 1.60% 59.80% 12.92% NA
Indica Intermediate  786 43.80% 0.50% 46.69% 9.03% NA
Temperate Japonica  767 99.50% 0.00% 0.39% 0.13% NA
Tropical Japonica  504 91.50% 0.00% 0.60% 7.94% NA
Japonica Intermediate  241 98.80% 0.00% 1.24% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 77.80% 0.00% 18.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102661323 G -> GA LOC_Os11g05770.1 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> GA LOC_Os11g05780.1 downstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> GA LOC_Os11g05770-LOC_Os11g05780 intergenic_region ; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> A LOC_Os11g05770.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> A LOC_Os11g05780.1 downstream_gene_variant ; 3891.0bp to feature; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> A LOC_Os11g05770-LOC_Os11g05780 intergenic_region ; MODIFIER silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N
vg1102661323 G -> DEL N N silent_mutation Average:59.289; most accessible tissue: Callus, score: 91.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102661323 NA 2.13E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102661323 2.89E-06 NA mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102661323 NA 8.59E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251