Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1102661323:

Variant ID: vg1102661323 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 2661323
Reference Allele: G	Alternative Allele: A,GA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATCTCTAGCCGAAATTTCTTCTAGCATACTCCTCCCGTGAAAAAAAAAAGATAAACCCTGGATTTCCGTGTCCAACGTTTGACCGTCCGTCTTATTT[G/A,GA]
AAAAAATTAGAAAGACAAGTTACGCATAAAGTATTGATCATATTTTATCATCTAATAACAATGAAAATACTAATTATAAAAAAATTTCATATAAAACGGA

Reverse complement sequence

TCCGTTTTATATGAAATTTTTTTATAATTAGTATTTTCATTGTTATTAGATGATAAAATATGATCAATACTTTATGCGTAACTTGTCTTTCTAATTTTTT[C/T,TC]
AAATAAGACGGACGGTCAAACGTTGGACACGGAAATCCAGGGTTTATCTTTTTTTTTTCACGGGAGGAGTATGCTAGAAGAAATTTCGGCTAGAGATAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	0.70%	31.57%	6.71%	GA: 0.02%
All Indica	2759	39.50%	1.10%	49.87%	9.60%	NA
All Japonica	1512	96.70%	0.00%	0.60%	2.71%	NA
Aus	269	63.90%	0.70%	31.97%	2.97%	GA: 0.37%
Indica I	595	70.40%	0.50%	27.39%	1.68%	NA
Indica II	465	19.80%	1.50%	64.52%	14.19%	NA
Indica III	913	25.60%	1.60%	59.80%	12.92%	NA
Indica Intermediate	786	43.80%	0.50%	46.69%	9.03%	NA
Temperate Japonica	767	99.50%	0.00%	0.39%	0.13%	NA
Tropical Japonica	504	91.50%	0.00%	0.60%	7.94%	NA
Japonica Intermediate	241	98.80%	0.00%	1.24%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	4.17%	0.00%	NA
Intermediate	90	77.80%	0.00%	18.89%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102661323	G -> GA	LOC_Os11g05770.1	downstream_gene_variant ; 825.0bp to feature; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> GA	LOC_Os11g05780.1	downstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> GA	LOC_Os11g05770-LOC_Os11g05780	intergenic_region ; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> A	LOC_Os11g05770.1	downstream_gene_variant ; 824.0bp to feature; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> A	LOC_Os11g05780.1	downstream_gene_variant ; 3891.0bp to feature; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> A	LOC_Os11g05770-LOC_Os11g05780	intergenic_region ; MODIFIER	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N
vg1102661323	G -> DEL	N	N	silent_mutation	Average:59.289; most accessible tissue: Callus, score: 91.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102661323	NA	2.13E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102661323	2.89E-06	NA	mr1860_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102661323	NA	8.59E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251