\
| Variant ID: vg1102661323 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 2661323 |
| Reference Allele: G | Alternative Allele: A,GA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTATCTCTAGCCGAAATTTCTTCTAGCATACTCCTCCCGTGAAAAAAAAAAGATAAACCCTGGATTTCCGTGTCCAACGTTTGACCGTCCGTCTTATTT[G/A,GA]
AAAAAATTAGAAAGACAAGTTACGCATAAAGTATTGATCATATTTTATCATCTAATAACAATGAAAATACTAATTATAAAAAAATTTCATATAAAACGGA
TCCGTTTTATATGAAATTTTTTTATAATTAGTATTTTCATTGTTATTAGATGATAAAATATGATCAATACTTTATGCGTAACTTGTCTTTCTAATTTTTT[C/T,TC]
AAATAAGACGGACGGTCAAACGTTGGACACGGAAATCCAGGGTTTATCTTTTTTTTTTCACGGGAGGAGTATGCTAGAAGAAATTTCGGCTAGAGATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 0.70% | 31.57% | 6.71% | GA: 0.02% |
| All Indica | 2759 | 39.50% | 1.10% | 49.87% | 9.60% | NA |
| All Japonica | 1512 | 96.70% | 0.00% | 0.60% | 2.71% | NA |
| Aus | 269 | 63.90% | 0.70% | 31.97% | 2.97% | GA: 0.37% |
| Indica I | 595 | 70.40% | 0.50% | 27.39% | 1.68% | NA |
| Indica II | 465 | 19.80% | 1.50% | 64.52% | 14.19% | NA |
| Indica III | 913 | 25.60% | 1.60% | 59.80% | 12.92% | NA |
| Indica Intermediate | 786 | 43.80% | 0.50% | 46.69% | 9.03% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 91.50% | 0.00% | 0.60% | 7.94% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 0.00% | 18.89% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1102661323 | G -> GA | LOC_Os11g05770.1 | downstream_gene_variant ; 825.0bp to feature; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> GA | LOC_Os11g05780.1 | downstream_gene_variant ; 3890.0bp to feature; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> GA | LOC_Os11g05770-LOC_Os11g05780 | intergenic_region ; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> A | LOC_Os11g05770.1 | downstream_gene_variant ; 824.0bp to feature; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> A | LOC_Os11g05780.1 | downstream_gene_variant ; 3891.0bp to feature; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> A | LOC_Os11g05770-LOC_Os11g05780 | intergenic_region ; MODIFIER | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| vg1102661323 | G -> DEL | N | N | silent_mutation | Average:59.289; most accessible tissue: Callus, score: 91.749 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1102661323 | NA | 2.13E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102661323 | 2.89E-06 | NA | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102661323 | NA | 8.59E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |