\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102472614:

Variant ID: vg1102472614 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2472614
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGAAACAACTGAAATTACAAATAAAAAATAAAAACATTAAAATAACACAATACGATATTAACTAATTTTTTTAGAAAAAAATTCTGAAATTAGAAAA[A/G]
GAAAAATAAGATTTCAATTAGGAATACAATTTATAAAAAACTAAATTTTTTATATAAAGGTTATTGAAAGAAAAGACCATCTAAAACACATGACGAGATA

Reverse complement sequence

TATCTCGTCATGTGTTTTAGATGGTCTTTTCTTTCAATAACCTTTATATAAAAAATTTAGTTTTTTATAAATTGTATTCCTAATTGAAATCTTATTTTTC[T/C]
TTTTCTAATTTCAGAATTTTTTTCTAAAAAAATTAGTTAATATCGTATTGTGTTATTTTAATGTTTTTATTTTTTATTTGTAATTTCAGTTGTTTCAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 39.90% 0.21% 0.00% NA
All Indica  2759 36.10% 63.50% 0.36% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 4.40% 95.50% 0.17% 0.00% NA
Indica II  465 59.40% 39.80% 0.86% 0.00% NA
Indica III  913 42.20% 57.70% 0.11% 0.00% NA
Indica Intermediate  786 39.30% 60.20% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102472614 A -> G LOC_Os11g05480.1 upstream_gene_variant ; 3881.0bp to feature; MODIFIER silent_mutation Average:25.086; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1102472614 A -> G LOC_Os11g05490.1 downstream_gene_variant ; 4041.0bp to feature; MODIFIER silent_mutation Average:25.086; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1102472614 A -> G LOC_Os11g05480-LOC_Os11g05490 intergenic_region ; MODIFIER silent_mutation Average:25.086; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102472614 NA 3.45E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 1.49E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 2.98E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 4.26E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 1.85E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 1.77E-08 1.25E-26 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 1.64E-07 1.57E-12 mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 2.81E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 1.53E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 9.15E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 5.85E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 2.24E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 1.26E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 7.27E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 8.01E-16 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102472614 NA 3.64E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251