\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102446506:

Variant ID: vg1102446506 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 2446506
Reference Allele: ATAlternative Allele: A
Primary Allele: ATSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTGATAGACTGTTTCTCCTCTTTAAAACCATTGGGGGGGTTAATGCACTGTCAAATGACAAATAAATGCACATTGTACGACGAATATATAACTATCAT[AT/A]
TGGTATTGGTAGGTTGTGTCTCTTTTGGGCTGAAATACAATTATAAAACAAAGAACTGTATAACATAAAAAATAACCACAAGAATGGTTGTTTTAATACT

Reverse complement sequence

AGTATTAAAACAACCATTCTTGTGGTTATTTTTTATGTTATACAGTTCTTTGTTTTATAATTGTATTTCAGCCCAAAAGAGACACAACCTACCAATACCA[AT/T]
ATGATAGTTATATATTCGTCGTACAATGTGCATTTATTTGTCATTTGACAGTGCATTAACCCCCCCAATGGTTTTAAAGAGGAGAAACAGTCTATCAGTC

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 2.20% 5.46% 14.30% NA
All Indica  2759 69.20% 0.60% 7.50% 22.73% NA
All Japonica  1512 98.10% 0.00% 0.60% 1.32% NA
Aus  269 51.70% 30.90% 11.15% 6.32% NA
Indica I  595 99.30% 0.00% 0.00% 0.67% NA
Indica II  465 41.70% 0.00% 12.69% 45.59% NA
Indica III  913 62.00% 0.90% 10.08% 27.05% NA
Indica Intermediate  786 70.90% 1.10% 7.12% 20.87% NA
Temperate Japonica  767 99.20% 0.00% 0.13% 0.65% NA
Tropical Japonica  504 96.40% 0.00% 0.60% 2.98% NA
Japonica Intermediate  241 97.90% 0.00% 2.07% 0.00% NA
VI/Aromatic  96 92.70% 0.00% 7.29% 0.00% NA
Intermediate  90 77.80% 3.30% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102446506 AT -> A LOC_Os11g05440.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N
vg1102446506 AT -> A LOC_Os11g05450.1 upstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N
vg1102446506 AT -> A LOC_Os11g05430.1 downstream_gene_variant ; 2623.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N
vg1102446506 AT -> A LOC_Os11g05460.1 downstream_gene_variant ; 3400.0bp to feature; MODIFIER silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N
vg1102446506 AT -> A LOC_Os11g05440-LOC_Os11g05450 intergenic_region ; MODIFIER silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N
vg1102446506 AT -> DEL N N silent_mutation Average:59.807; most accessible tissue: Callus, score: 91.54 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102446506 NA 2.29E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 5.87E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 3.60E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.30E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 7.49E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 4.87E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.17E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 4.33E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 9.25E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 4.58E-11 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.58E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 8.71E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.35E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.77E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 2.75E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 6.59E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.83E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 4.15E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 3.86E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.42E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 3.12E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 2.84E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 NA 1.27E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506 5.38E-06 NA mr1944_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251