Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102446506:

Variant ID: vg1102446506 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 2446506
Reference Allele: AT	Alternative Allele: A
Primary Allele: AT	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTGATAGACTGTTTCTCCTCTTTAAAACCATTGGGGGGGTTAATGCACTGTCAAATGACAAATAAATGCACATTGTACGACGAATATATAACTATCAT[AT/A]
TGGTATTGGTAGGTTGTGTCTCTTTTGGGCTGAAATACAATTATAAAACAAAGAACTGTATAACATAAAAAATAACCACAAGAATGGTTGTTTTAATACT

Reverse complement sequence

AGTATTAAAACAACCATTCTTGTGGTTATTTTTTATGTTATACAGTTCTTTGTTTTATAATTGTATTTCAGCCCAAAAGAGACACAACCTACCAATACCA[AT/T]
ATGATAGTTATATATTCGTCGTACAATGTGCATTTATTTGTCATTTGACAGTGCATTAACCCCCCCAATGGTTTTAAAGAGGAGAAACAGTCTATCAGTC

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	2.20%	5.46%	14.30%	NA
All Indica	2759	69.20%	0.60%	7.50%	22.73%	NA
All Japonica	1512	98.10%	0.00%	0.60%	1.32%	NA
Aus	269	51.70%	30.90%	11.15%	6.32%	NA
Indica I	595	99.30%	0.00%	0.00%	0.67%	NA
Indica II	465	41.70%	0.00%	12.69%	45.59%	NA
Indica III	913	62.00%	0.90%	10.08%	27.05%	NA
Indica Intermediate	786	70.90%	1.10%	7.12%	20.87%	NA
Temperate Japonica	767	99.20%	0.00%	0.13%	0.65%	NA
Tropical Japonica	504	96.40%	0.00%	0.60%	2.98%	NA
Japonica Intermediate	241	97.90%	0.00%	2.07%	0.00%	NA
VI/Aromatic	96	92.70%	0.00%	7.29%	0.00%	NA
Intermediate	90	77.80%	3.30%	5.56%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102446506	AT -> A	LOC_Os11g05440.1	upstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N
vg1102446506	AT -> A	LOC_Os11g05450.1	upstream_gene_variant ; 1684.0bp to feature; MODIFIER	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N
vg1102446506	AT -> A	LOC_Os11g05430.1	downstream_gene_variant ; 2623.0bp to feature; MODIFIER	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N
vg1102446506	AT -> A	LOC_Os11g05460.1	downstream_gene_variant ; 3400.0bp to feature; MODIFIER	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N
vg1102446506	AT -> A	LOC_Os11g05440-LOC_Os11g05450	intergenic_region ; MODIFIER	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N
vg1102446506	AT -> DEL	N	N	silent_mutation	Average:59.807; most accessible tissue: Callus, score: 91.54	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102446506	NA	2.29E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	5.87E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	3.60E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.30E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	7.49E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	4.87E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.17E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	4.33E-09	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	9.25E-07	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	4.58E-11	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.58E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	8.71E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.35E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.77E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	2.75E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	6.59E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.83E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	4.15E-12	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	3.86E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.42E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	3.12E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	2.84E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	NA	1.27E-09	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102446506	5.38E-06	NA	mr1944_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251