\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102103328:

Variant ID: vg1102103328 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2103328
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGCAGTGGGGAGGTGGAGTAGCAACGAGGAGGGCTAGGACGCAGCCAGTTGATGCCGGCAGAGGAGCCACTCGGCGCCGAAGCACCAGCAGAGGAAG[A/G]
CAAGGGATTCGCTGCTGCCTCTGACCCCTTTGCCGCCGGGAACTGAAGAAGAGAATAAAAGAAAAGAGAAAATTAAAGAAAAAAAGAGATGTAGACCTCA

Reverse complement sequence

TGAGGTCTACATCTCTTTTTTTCTTTAATTTTCTCTTTTCTTTTATTCTCTTCTTCAGTTCCCGGCGGCAAAGGGGTCAGAGGCAGCAGCGAATCCCTTG[T/C]
CTTCCTCTGCTGGTGCTTCGGCGCCGAGTGGCTCCTCTGCCGGCATCAACTGGCTGCGTCCTAGCCCTCCTCGTTGCTACTCCACCTCCCCACTGCTTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 20.90% 0.55% 44.27% NA
All Indica  2759 2.60% 25.80% 0.72% 70.82% NA
All Japonica  1512 96.80% 0.90% 0.07% 2.25% NA
Aus  269 0.70% 71.70% 0.74% 26.77% NA
Indica I  595 1.30% 80.50% 0.34% 17.82% NA
Indica II  465 3.20% 4.70% 1.51% 90.54% NA
Indica III  913 0.80% 3.50% 0.55% 95.18% NA
Indica Intermediate  786 5.30% 22.90% 0.76% 70.99% NA
Temperate Japonica  767 97.30% 0.00% 0.00% 2.74% NA
Tropical Japonica  504 97.20% 0.60% 0.00% 2.18% NA
Japonica Intermediate  241 94.60% 4.10% 0.41% 0.83% NA
VI/Aromatic  96 38.50% 52.10% 1.04% 8.33% NA
Intermediate  90 52.20% 18.90% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102103328 A -> DEL N N silent_mutation Average:12.301; most accessible tissue: Callus, score: 62.327 N N N N
vg1102103328 A -> G LOC_Os11g04930.1 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:12.301; most accessible tissue: Callus, score: 62.327 N N N N
vg1102103328 A -> G LOC_Os11g04920.1 downstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:12.301; most accessible tissue: Callus, score: 62.327 N N N N
vg1102103328 A -> G LOC_Os11g04935.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:12.301; most accessible tissue: Callus, score: 62.327 N N N N
vg1102103328 A -> G LOC_Os11g04920-LOC_Os11g04930 intergenic_region ; MODIFIER silent_mutation Average:12.301; most accessible tissue: Callus, score: 62.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102103328 NA 1.79E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 8.61E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 2.62E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 7.16E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 5.72E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.06E-11 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 8.07E-07 3.91E-10 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 5.23E-16 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 4.22E-06 6.09E-12 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 3.89E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 5.86E-07 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 5.39E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.30E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.51E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.94E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.29E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 5.92E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 4.92E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 4.40E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 4.70E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.00E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 3.48E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 2.24E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 8.61E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.16E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 4.97E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 9.22E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 6.80E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 1.75E-06 3.74E-16 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 5.54E-06 2.77E-09 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 4.80E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.56E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 1.43E-06 6.75E-22 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 1.48E-06 1.42E-13 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103328 NA 1.40E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251